ID: 1021700378

View in Genome Browser
Species Human (GRCh38)
Location 7:23314001-23314023
Sequence AAAATGCAACTGATGTCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 261}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021700378_1021700383 19 Left 1021700378 7:23314001-23314023 CCATGAGACATCAGTTGCATTTT 0: 1
1: 0
2: 1
3: 26
4: 261
Right 1021700383 7:23314043-23314065 TCAGGGTCCTCCTGTTGTCCAGG No data
1021700378_1021700379 -6 Left 1021700378 7:23314001-23314023 CCATGAGACATCAGTTGCATTTT 0: 1
1: 0
2: 1
3: 26
4: 261
Right 1021700379 7:23314018-23314040 CATTTTTCTTTCCTTTTTGTTGG 0: 1
1: 0
2: 42
3: 410
4: 3006
1021700378_1021700384 23 Left 1021700378 7:23314001-23314023 CCATGAGACATCAGTTGCATTTT 0: 1
1: 0
2: 1
3: 26
4: 261
Right 1021700384 7:23314047-23314069 GGTCCTCCTGTTGTCCAGGCTGG No data
1021700378_1021700380 1 Left 1021700378 7:23314001-23314023 CCATGAGACATCAGTTGCATTTT 0: 1
1: 0
2: 1
3: 26
4: 261
Right 1021700380 7:23314025-23314047 CTTTCCTTTTTGTTGGAGTCAGG 0: 1
1: 0
2: 4
3: 82
4: 985
1021700378_1021700381 2 Left 1021700378 7:23314001-23314023 CCATGAGACATCAGTTGCATTTT 0: 1
1: 0
2: 1
3: 26
4: 261
Right 1021700381 7:23314026-23314048 TTTCCTTTTTGTTGGAGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021700378 Original CRISPR AAAATGCAACTGATGTCTCA TGG (reversed) Intronic
900561106 1:3307197-3307219 AAAATGGAACTGCTGGGTCATGG + Intronic
900869618 1:5292779-5292801 AAAATGCAACTGATCTGACTTGG - Intergenic
901872198 1:12144800-12144822 AAAATGCCACTGTTGTCACAAGG + Intergenic
904501254 1:30914040-30914062 AAAATGAAGCTGATGCTTCAGGG - Intergenic
909747975 1:79122687-79122709 AAAATGTAAATGGTGTCTAAGGG + Intergenic
912770474 1:112459574-112459596 AAAATGCTACTAATGCCCCAAGG + Exonic
913150596 1:116038763-116038785 AAAATGAAACTGAATTCTCAAGG - Intronic
913610506 1:120505569-120505591 AAAATGCAAGAGCTGTATCAGGG - Intergenic
914580684 1:149016670-149016692 AAAATGCAAGAGCTGTATCAGGG + Intronic
916259267 1:162824486-162824508 ACTATGCAACTGATATCTAAGGG - Intronic
917659883 1:177167165-177167187 AAAATGGAAATAATGTCACATGG + Intergenic
918160490 1:181894408-181894430 AAATTGCAAATGAAGTCTGAAGG - Intergenic
918885490 1:190188187-190188209 GAAATGCTACTGATTTCTGAAGG + Intronic
919997236 1:202764200-202764222 AAAATCCAACTGGAATCTCAAGG + Intronic
920132053 1:203739836-203739858 AAATTCAAACTGATGTCTCTAGG - Exonic
920766662 1:208840140-208840162 CAAATGCATCTGCTGTCCCAGGG - Intergenic
922120884 1:222666471-222666493 AAAATGAAAATGATGTGTCATGG + Exonic
923440749 1:234017865-234017887 GAACTACAACTCATGTCTCAAGG + Intronic
923541622 1:234892492-234892514 ATAATGCAAGTGTTGTCACAAGG + Intergenic
923811573 1:237323848-237323870 CAAATGAAGCTGATGTCTCTGGG - Intronic
924093195 1:240523401-240523423 AAACTGCTACTGGTGTCTAATGG - Intronic
1065436954 10:25712799-25712821 AAAATGCTACTGCTGTCACATGG - Intergenic
1065441859 10:25761344-25761366 AAAAACCAACAGATGCCTCAAGG + Intergenic
1066058336 10:31701480-31701502 CAAAAGCAACTGATGGCCCATGG + Intergenic
1069471347 10:68692860-68692882 CAAATGCTTCTAATGTCTCAAGG + Exonic
1071417137 10:85451904-85451926 AAAAAGCAACAGAAGTCTCATGG - Intergenic
1072659477 10:97354774-97354796 AAAATACACCTGAAGTTTCAGGG + Intergenic
1074493908 10:113962028-113962050 AAAAGTCAACTGACTTCTCAAGG + Intergenic
1075614366 10:123880895-123880917 AAACTACAAATGATGTCTCTGGG - Intronic
1075972456 10:126666201-126666223 AAAATGCTACTGGTGGCTAATGG - Intronic
1078900226 11:15635184-15635206 ATAATCACACTGATGTCTCAAGG + Intergenic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1079538799 11:21547127-21547149 AAAAAGCAACTAACTTCTCATGG + Intronic
1080118830 11:28651036-28651058 AAAAGGCAACAGATGTCTTTGGG - Intergenic
1081118728 11:39237146-39237168 AGAAAGCAGCTGGTGTCTCAAGG - Intergenic
1081401427 11:42647659-42647681 AAAAGGCAAATGATGTTTCAGGG - Intergenic
1087251205 11:95902435-95902457 AAAATGCAAATGATGTTGAAGGG - Intronic
1089307905 11:117538303-117538325 GAAATAGAACTGATGTCACAGGG + Intronic
1089392248 11:118110113-118110135 AAAATGCATCTGTAGGCTCAAGG + Intronic
1092526254 12:9311996-9312018 AAAATCCAACTACTCTCTCAGGG - Intergenic
1092541020 12:9419794-9419816 AAAATCCAACTGCTCTCCCAGGG + Intergenic
1092573367 12:9749932-9749954 AAAATGTAAATGATTTTTCAGGG - Intergenic
1093700095 12:22210577-22210599 GACTTGCAACTGATGTCTAAGGG - Intronic
1093739736 12:22671073-22671095 AAAATTCAAATTATGTCTCTTGG - Intronic
1093830741 12:23754327-23754349 AGAATGCATCTTATGCCTCAGGG + Intronic
1094230800 12:28100869-28100891 AAATTGGAACTGAAATCTCATGG + Intergenic
1094665543 12:32516795-32516817 AAAATGCCACTGATCTATGAAGG + Intronic
1094784380 12:33829370-33829392 AATATGGAAGTGAAGTCTCATGG - Intergenic
1095210091 12:39483750-39483772 AAAATGTTACTGATGAATCATGG + Intergenic
1096309367 12:50506190-50506212 AAAATGCTGCTTTTGTCTCAGGG - Intronic
1097175511 12:57140470-57140492 AAAATGCAAAAGATCTCTAAAGG - Intronic
1097655397 12:62355492-62355514 AAAATGAAACTCATGTTTCATGG + Intronic
1099019226 12:77382407-77382429 AGAATGCTTCTGATGTCTCGTGG - Intergenic
1100438847 12:94596922-94596944 AATAGGAAACTGATGTTTCATGG + Intronic
1100557841 12:95714723-95714745 AAAATGCCACCCATGTGTCAAGG - Intronic
1100889065 12:99103451-99103473 AAAATTCTACTGATCTTTCAAGG + Intronic
1102913191 12:116734409-116734431 AAAATGAAGATGATGTATCAGGG + Intronic
1103502793 12:121417070-121417092 GAAAGGCAACTGATCTCTCAAGG - Intronic
1104318289 12:127724609-127724631 AAAATGCAACTTTTGTCTGAAGG - Intergenic
1104323905 12:127777729-127777751 AAAATGTCACTGGAGTCTCAGGG - Intergenic
1105894843 13:24709164-24709186 AAAAAGCAGCTGATTTCTAAAGG + Intronic
1105995501 13:25667473-25667495 GAAATGCAAAGGATGTCTTAAGG - Intronic
1106248926 13:27969403-27969425 AAAATGCAAATTATGTTTCGAGG - Exonic
1110488485 13:76073965-76073987 AAAATTCAAGTTAAGTCTCAAGG - Intergenic
1112112384 13:96316451-96316473 CAAATGCAACTTATTTGTCATGG + Intronic
1112238727 13:97659943-97659965 AAAATGTAATTCAAGTCTCAAGG - Intergenic
1112297008 13:98196947-98196969 AAAATACAACAGATGTGTAAAGG - Intronic
1112892944 13:104260934-104260956 AAAATGCATATGATGTCACCTGG - Intergenic
1113058699 13:106297899-106297921 AAAATACAATGGTTGTCTCAAGG + Intergenic
1115455296 14:33594871-33594893 AAAATGTAGCTGGTGTTTCAGGG + Intronic
1115479129 14:33844485-33844507 AGAATGCAACTCTTGTCTCCTGG + Intergenic
1115721367 14:36164748-36164770 AAAATGGTTCTGATGTCTCCTGG - Intergenic
1116643765 14:47500041-47500063 AATATGCAAATGATTTTTCAGGG - Intronic
1117693774 14:58338182-58338204 AAAATTCAACAGATGTCTGTAGG + Intronic
1118104927 14:62647639-62647661 AAAAAGCAACTGATGTCCTCAGG + Intergenic
1119997219 14:79266515-79266537 AAAATGCATCTGATGTTTTTTGG - Intronic
1124004469 15:25785058-25785080 AAAAGGCAAGAGATGCCTCAGGG + Intronic
1125076697 15:35627571-35627593 AAAATGCATATGATATCTAACGG + Intergenic
1127466683 15:59250682-59250704 AACATGCAGCTGATGTCTGCAGG + Intronic
1127862169 15:63003358-63003380 AAAATGCAAATTCTTTCTCAGGG + Intergenic
1127897388 15:63314144-63314166 GATATGCAACTGGTGTCTGAAGG - Intergenic
1128725969 15:69988859-69988881 AAAATGAGACTGATGTTTCTGGG + Intergenic
1130904461 15:88230087-88230109 ACAATGGAACTGAGGTCACATGG - Intronic
1133396310 16:5450252-5450274 AAAATGCAAATGAGGTAACAAGG + Intergenic
1133482657 16:6186255-6186277 AATATACAACTGATGACTCTGGG + Intronic
1135204220 16:20469057-20469079 AAAATGCATTTAATGTCCCAGGG + Intronic
1135214783 16:20555909-20555931 AAAATGCATTTAATGTCCCAGGG - Intronic
1136014792 16:27389387-27389409 AAAATAAACCTGCTGTCTCAGGG + Intergenic
1136714609 16:32268452-32268474 AAAATTCAAGTGAAATCTCAAGG - Intergenic
1136753298 16:32661295-32661317 AAAATTCAAGTGAAATCTCAAGG + Intergenic
1136814815 16:33209070-33209092 AAAATTCAAGTGAAATCTCAAGG - Intronic
1136821291 16:33319150-33319172 AAAATTCAAGTGAAATCTCAAGG - Intergenic
1136827854 16:33375689-33375711 AAAATTCAAGTGAAATCTCAAGG - Intergenic
1136832920 16:33474460-33474482 AAAATTCAAGTGAAATCTCAAGG - Intergenic
1137648098 16:50093499-50093521 AAATTGCAACTGGTGTCTAGAGG + Intronic
1138725531 16:59134458-59134480 AGAATGCAAATGAAGTCACAAGG - Intergenic
1140197771 16:72869556-72869578 AAAATGTCACTGATCACTCATGG - Intronic
1140486367 16:75296740-75296762 AGGATGCAACTGAATTCTCAAGG + Intronic
1140835874 16:78793145-78793167 TCACTGCAACTGCTGTCTCATGG + Intronic
1141371144 16:83487358-83487380 AAAGTGGACCTGATGTCTCCAGG - Intronic
1141372629 16:83501786-83501808 AAAATCTGACAGATGTCTCAAGG + Intronic
1203055442 16_KI270728v1_random:921317-921339 AAAATTCAAGTGAAATCTCAAGG + Intergenic
1144515167 17:15912392-15912414 AAAATGCAGGTGGTGTTTCAGGG + Intergenic
1145888997 17:28401850-28401872 AAAATGAAACCCATGTCACAAGG + Exonic
1146108339 17:30063354-30063376 CAAAGGCAACTCAGGTCTCAGGG - Intronic
1147324589 17:39664146-39664168 AAAATGGGACTGATGTCACAGGG + Intergenic
1149057625 17:52384343-52384365 AAAATGCAAATATTGTCACAAGG + Intergenic
1150270832 17:63863644-63863666 GAAATGCAACTCATATTTCATGG + Intergenic
1151242668 17:72770320-72770342 AAAATGAAGTTGGTGTCTCATGG + Intronic
1152051284 17:77980659-77980681 GACTTGCAACTGGTGTCTCAAGG - Intergenic
1152620434 17:81361535-81361557 AAAAGGCAAGAGATGGCTCAAGG - Intergenic
1153053158 18:919402-919424 GAAATGCTACTGATCTTTCAGGG + Intergenic
1155884872 18:31195669-31195691 AAATGGCAACTGTTGCCTCATGG - Intergenic
1156775086 18:40777739-40777761 AAAATAGAACAGATGTCACAAGG + Intergenic
1159228472 18:65572786-65572808 AAAATTCCACTGATATCTAATGG + Intergenic
1159550282 18:69887710-69887732 AAAATGCCACTCATATCTAAAGG + Intronic
1164697274 19:30255099-30255121 AAAATGCAAATTATGCCACACGG - Intronic
1165268707 19:34685144-34685166 TGAATGCAACAAATGTCTCAAGG + Exonic
1166021452 19:40034388-40034410 AAGTTGCTACTGATGTCTGAAGG + Exonic
1167425329 19:49427230-49427252 AAAATGCAACAGATGTACCCAGG + Exonic
1167840347 19:52112144-52112166 AAAATGTATCAGAAGTCTCATGG - Intergenic
1168521190 19:57051803-57051825 ATACTGAAACTGGTGTCTCAAGG - Intergenic
928154256 2:28861802-28861824 AAAATGGAATTGCTGGCTCAAGG + Intronic
928222968 2:29420392-29420414 AGCATGAAACTGATGCCTCAAGG - Intronic
928410990 2:31053602-31053624 AAAATGGAGCAGATGCCTCAGGG - Intronic
931954496 2:67405115-67405137 AAAATCCAACTGTTGTGTTAAGG - Exonic
935308227 2:101758801-101758823 AAAATGAAAGTGATCTCTTATGG + Intronic
935733142 2:106082827-106082849 AAAATGCAAGTGCTGTCTGGAGG - Intergenic
936688308 2:114854752-114854774 AAAGTGCCACTGATGCCCCATGG - Intronic
936895777 2:117425961-117425983 AATATGCAGATGAAGTCTCAAGG - Intergenic
937769471 2:125703155-125703177 TAAATGCACCTGATGTTTCCAGG + Intergenic
938590172 2:132728332-132728354 AAAATGAAACTCAGGGCTCACGG + Intronic
939273391 2:139969159-139969181 AATATGAAACTTATGTCTCTAGG + Intergenic
939563481 2:143759099-143759121 AAATTGCTACTGGTGTCTAATGG - Intronic
940025678 2:149204818-149204840 CAAATGCAAATGTTGACTCAAGG + Intronic
940924873 2:159353487-159353509 AAGATGCAACTGAAAGCTCAGGG + Intronic
943813970 2:192227650-192227672 AAACTTCAACTGATGTGTCAAGG - Intergenic
944428250 2:199606078-199606100 AAAAAGCAACTGTTAGCTCAGGG - Intergenic
945401071 2:209383395-209383417 AAATTGCATTTGATGTTTCAAGG + Intergenic
946095240 2:217269143-217269165 TAAATGCAGCAGATGTCACATGG + Intergenic
946663985 2:222030421-222030443 AAAATGCAACTCTTTTCTCAAGG - Intergenic
1170221722 20:13948267-13948289 AAAATTCAAATGAAATCTCAAGG + Intronic
1171321050 20:24244713-24244735 AAATTGCAGCTGGTGTCTGAAGG + Intergenic
1174035771 20:47667515-47667537 GAAAGGAAACAGATGTCTCACGG + Intronic
1174613171 20:51815720-51815742 AACATGACACTGATGTGTCAAGG + Intergenic
1175058888 20:56223500-56223522 AACATGCCACTGATGGCTCAAGG + Intergenic
1177114562 21:17070504-17070526 AAAATGTGACTGATGGCTGATGG - Intergenic
1177260097 21:18718882-18718904 AAAATGGAAATTATTTCTCAGGG + Intergenic
1177642928 21:23867389-23867411 AAAATGCCAATAACGTCTCAGGG - Intergenic
1181320632 22:22003167-22003189 CAAATGCAACTGTTGGCTCATGG + Intergenic
949405304 3:3707687-3707709 AAAGAGCAACTGATGCCTCATGG - Intronic
952057066 3:29460476-29460498 AAAATGCCACTGATGTATCTGGG + Intronic
952216272 3:31280810-31280832 AGAAAGCAAGTGATTTCTCAAGG + Intergenic
953765062 3:45733620-45733642 AAAATGCAACAGATTCATCAAGG - Intronic
955012964 3:55037436-55037458 AAAGTGCCACTGATGTCTGAGGG - Intronic
955858757 3:63304016-63304038 AGAATTCATGTGATGTCTCAAGG - Intronic
957387909 3:79520772-79520794 ATAATGAAACTAATGTCTCTTGG + Intronic
959034939 3:101350180-101350202 AAAATGCAACTCATGTGTCAGGG + Intronic
965794082 3:172420288-172420310 AAAATGACACTGGTGGCTCAAGG - Intergenic
965878463 3:173358023-173358045 CAAATGCATATGATGTTTCAAGG + Intergenic
966033402 3:175378544-175378566 AGATTGCATCTGAAGTCTCAAGG + Intronic
966403054 3:179566161-179566183 TAATTGCATCTGATGCCTCATGG - Intronic
966508423 3:180733321-180733343 CTAATGCAACTGATATATCAGGG + Intronic
970127201 4:12828195-12828217 AAAATGCAGCTGATGTGGCCAGG - Intergenic
971133845 4:23844267-23844289 AAAATACAACTAATGACACAAGG + Intronic
971134548 4:23854139-23854161 AAAATACAACTAATGACACAAGG + Intronic
971564280 4:28117790-28117812 AAAATGCCACTTAGGTCTTAAGG - Intergenic
972591429 4:40491869-40491891 AAAGTGTAACTGAAGTATCAAGG + Intronic
972871436 4:43304638-43304660 CAAATGCTACTGTTTTCTCAAGG + Intergenic
974149032 4:57981817-57981839 AAAAGGCAGGTGAGGTCTCAGGG + Intergenic
975961968 4:79920248-79920270 AAAATGCAAACGATGTGTCTGGG + Intronic
976104132 4:81598767-81598789 ATAATGAATATGATGTCTCAAGG + Intronic
976240250 4:82947833-82947855 AAAAGACAACTGATGTATGATGG + Intronic
976535782 4:86214917-86214939 AAAATTCATATGAAGTCTCAAGG + Intronic
977152455 4:93529805-93529827 AAAATGTAAACGATGTCACAAGG - Intronic
977628080 4:99210269-99210291 AAAACCCAACTGATGTCTGATGG - Exonic
977689046 4:99882982-99883004 AAAAAGCATCTGAACTCTCAAGG + Intronic
978722862 4:111933678-111933700 AAAAAGAAACTGATATTTCAAGG + Intergenic
981504023 4:145481248-145481270 AAAACGCATCTGTTGACTCAGGG + Intronic
982739155 4:159039673-159039695 AAAAGGCATCTGGTGGCTCATGG - Intergenic
983336686 4:166403299-166403321 AAAATTCACCTGAAATCTCAAGG + Intergenic
984256246 4:177393093-177393115 AAAATGGAAATGATCTCTGAAGG - Intergenic
984946774 4:184975026-184975048 AAACTTTATCTGATGTCTCATGG + Intergenic
986596254 5:9425410-9425432 AGAATGCAAGTTATTTCTCATGG + Intronic
987761777 5:22173101-22173123 AAAATGTAAATGATGTATTACGG - Intronic
988421694 5:31013713-31013735 AAAATGTGAATGATGTCTCCTGG - Intergenic
989141300 5:38204293-38204315 AGAATGAAAGTGATGTCTCTGGG + Intergenic
989260560 5:39415140-39415162 AAGATGCAAATGTTGTCTGAAGG + Intronic
989488421 5:42020715-42020737 CAACTTCAACTTATGTCTCATGG + Intergenic
991475678 5:67016500-67016522 AAAATGCTGCTGCTGTCTGAGGG + Intronic
992728134 5:79630213-79630235 AGAATGCATTTGAGGTCTCAGGG + Intronic
993379877 5:87194434-87194456 AAAATGCATCTGATGGCACCAGG - Intergenic
993472447 5:88322458-88322480 AAAATGCAAATAATCCCTCAGGG + Intergenic
994610811 5:102036948-102036970 AAAATCTAACTGATGCCTGATGG - Intergenic
994677202 5:102838922-102838944 GAATTGGAAATGATGTCTCAAGG - Intronic
995348382 5:111147346-111147368 CAAATGCAAGTGATGGCCCATGG + Intergenic
996392786 5:122980571-122980593 AAAACTCAACTAATTTCTCAAGG + Intronic
996550411 5:124724414-124724436 TAAATGCAACTAATTTCTCAGGG + Intronic
996968035 5:129329269-129329291 GAAATGGAACAGATGTCTCAGGG - Intergenic
997747764 5:136314492-136314514 AAGATGAAATTGATGACTCATGG - Intronic
997787499 5:136727071-136727093 AAAATGCACCTACTGTCTGAGGG + Intergenic
997913342 5:137898528-137898550 AAAATCCATCTGTTGTCTCAGGG - Intronic
998171549 5:139874874-139874896 AAAATACAACAAGTGTCTCAGGG + Intronic
999185280 5:149702894-149702916 AGAGTGAAACTGAGGTCTCAGGG - Intergenic
1000971208 5:167716585-167716607 AAAATGCAACTTTTTTTTCAAGG - Intronic
1001258583 5:170205321-170205343 AAAAGCCAGCTGATGTCCCAAGG - Intergenic
1002778167 6:346277-346299 AAAAAGCCACTGAGGTTTCAAGG - Intronic
1005270250 6:24156113-24156135 AAAAGGCTGCTGATGTGTCACGG + Intergenic
1005897000 6:30186908-30186930 AAAATGGAACAGATTTTTCAGGG - Intronic
1006420050 6:33927378-33927400 AAAATGCAAATGCTGTCTGAGGG - Intergenic
1007605834 6:43117351-43117373 AAAATGCAATTGGTGTTCCACGG - Intronic
1007825374 6:44595942-44595964 AAAATGAAAATGATCTCCCAGGG - Intergenic
1009279998 6:61736731-61736753 GAAATGCTACTGATTCCTCAAGG + Intronic
1010250178 6:73698913-73698935 ATAATGAAACTGATTTCCCAGGG + Intronic
1010732591 6:79406425-79406447 ACAATGGTACTGATGTCTGAAGG - Intergenic
1011414928 6:87108349-87108371 AAACTCCAACTCATTTCTCAAGG - Intergenic
1011501836 6:87999170-87999192 AAAGTACAACGGTTGTCTCAAGG - Intergenic
1011875959 6:91962045-91962067 AAAATGCCATAGAAGTCTCATGG + Intergenic
1012256206 6:97035687-97035709 AAAAATCCACTGATGTCTTATGG + Intronic
1014484058 6:121977641-121977663 AAATTGCACCTGATCTATCATGG - Intergenic
1014671655 6:124312376-124312398 GACATGCAACTGGTGTCTGAAGG - Intronic
1015351303 6:132223502-132223524 AAAATGCAATAGATCTGTCAAGG + Intergenic
1016463261 6:144300967-144300989 AAAATGTAAATATTGTCTCAGGG + Intronic
1017426989 6:154332192-154332214 CAAATGCAACTGAAATATCAGGG + Intronic
1017711766 6:157175698-157175720 AAAATGTCACGGATGTATCAGGG + Intronic
1018450438 6:163902347-163902369 AAAATGGAACTGTTGCATCATGG + Intergenic
1018518204 6:164611669-164611691 AATATGCAACTAATTCCTCAAGG - Intergenic
1019361406 7:606039-606061 GAAATGCAACTGCTATCTCTTGG - Intronic
1021461916 7:20898369-20898391 AGAGATCAACTGATGTCTCAGGG - Intergenic
1021700378 7:23314001-23314023 AAAATGCAACTGATGTCTCATGG - Intronic
1021791604 7:24211506-24211528 AAAATGCAAATAATTCCTCATGG - Intergenic
1022212108 7:28221480-28221502 AAACTGTAGCTGATGTCTTAAGG - Intergenic
1022775296 7:33521085-33521107 AAAATACTAATGATGTCTGATGG - Intronic
1024350703 7:48359766-48359788 AAAAACCAGCTGATTTCTCAGGG + Intronic
1025000332 7:55310592-55310614 AAAATGCTAATGATTTCCCAGGG - Intergenic
1026538540 7:71260570-71260592 AAAATCCAAATAGTGTCTCAAGG - Intronic
1026930895 7:74222425-74222447 AAAGGGCAACTGAGGACTCAGGG + Intronic
1027528995 7:79306688-79306710 ACAATGCCACTGAAGTGTCATGG - Intronic
1028095983 7:86761471-86761493 GAAATGCATCTGATGTGACAAGG + Intronic
1028303456 7:89231199-89231221 AAAATGCTATTTGTGTCTCATGG + Intronic
1028310682 7:89330194-89330216 AGAATGCAACTGTGGTTTCAAGG + Intronic
1028348833 7:89818402-89818424 AAAATGAAACTAATGTTTCTTGG - Intergenic
1028501092 7:91519793-91519815 AGAAAGAAACTGATTTCTCATGG - Intergenic
1030242041 7:107338158-107338180 AAAATTCACATGAAGTCTCAAGG + Intronic
1030393682 7:108958940-108958962 AAAATACAAGTAATGTCTCATGG + Intergenic
1032549923 7:132775407-132775429 AACATGCAATTGATGTTTCTTGG + Intergenic
1034730706 7:153385238-153385260 AAGATGCAGCTCATTTCTCATGG + Intergenic
1034828686 7:154290250-154290272 AAAATTAAAATGATGTATCAAGG - Intronic
1035621218 8:1036874-1036896 AAAAAGCAGCTTATGTTTCAAGG - Intergenic
1035664418 8:1370232-1370254 AAAATGGAGGTGATGTCCCACGG + Intergenic
1037554067 8:20004813-20004835 AAACTGCAGCTGAAGACTCAGGG - Intergenic
1039360508 8:36871999-36872021 ACTATGCAAGTCATGTCTCAAGG - Intronic
1039558610 8:38495303-38495325 AAAATGCAAATGATGGCTGTTGG + Intergenic
1041483250 8:58346080-58346102 AAAATGAAGCTGATATCTAATGG + Intergenic
1041543730 8:59016687-59016709 AAAATGCAAGCAATGTCACAAGG + Intronic
1042037976 8:64558075-64558097 AAAATGGAAATGATACCTCATGG - Intergenic
1044025351 8:87163629-87163651 AAAATGCAACTGATATTTGTAGG + Intronic
1044168115 8:89014509-89014531 AGAATGAAAATGATGTCTCAAGG + Intergenic
1044701278 8:94967498-94967520 ATAATGCAACAGATGACTAAAGG - Intronic
1046642189 8:116744326-116744348 AAAATGCAGCTGATGTTTAAAGG + Intronic
1047450906 8:124964261-124964283 TAAATGCAAGTGAGGTCTGAGGG - Intergenic
1048624195 8:136166924-136166946 GAAATGCACCTGCTTTCTCAGGG - Intergenic
1050538384 9:6649376-6649398 GAATTGCAACTGATGTCTTGGGG + Intergenic
1051592724 9:18792919-18792941 AAAAAGCAACTAATGTTTGATGG + Intronic
1051793433 9:20835572-20835594 ACATTGCTACTGATGTTTCAAGG + Intronic
1052448551 9:28595491-28595513 AAAATACAATTAATTTCTCAGGG + Intronic
1052712520 9:32074349-32074371 AAGCTGCAACTGATAGCTCAAGG - Intergenic
1054961340 9:70973558-70973580 AAAATGAAAAAGATGACTCATGG + Intronic
1055538566 9:77276742-77276764 AAAAAGCAACTGAGGCCTAAGGG - Intronic
1056148649 9:83762223-83762245 GAAATGCTACTGATTTTTCAAGG - Intronic
1056564977 9:87763541-87763563 TAGATGAAACTGATGTCTTATGG - Intergenic
1056567555 9:87787917-87787939 TAGATGACACTGATGTCTCATGG + Intergenic
1056588174 9:87942132-87942154 AAAATGCAACTGATTATTCCTGG - Intergenic
1056608692 9:88110813-88110835 AAAATGCAACTGATTATTCCTGG + Intergenic
1061458362 9:130715543-130715565 AAAATAGAACTAATGTTTCAAGG - Intronic
1186255062 X:7709190-7709212 GACTTGCAACTGGTGTCTCAGGG + Intergenic
1187000902 X:15176544-15176566 AAAAACCAACTCATGTCTTAAGG + Intergenic
1187217048 X:17287320-17287342 AAGATGCAGCTAATGTCTCCAGG + Intergenic
1187288715 X:17931602-17931624 AAAATAATACTGATTTCTCAAGG + Intergenic
1187947794 X:24443253-24443275 AAAATACAACTGATTCCTCATGG - Intergenic
1188327550 X:28823979-28824001 AAAATGCAACTGAGATCCAATGG - Intronic
1188714679 X:33447429-33447451 GAAATGCACCTGATCTATCATGG + Intergenic
1188973340 X:36643667-36643689 AAAATGCCAGTGATGTCATATGG + Intergenic
1189210913 X:39281163-39281185 AAAATGCTACTGATTTTTGATGG - Intergenic
1189806812 X:44743484-44743506 AAAATGGACCTTATTTCTCAAGG - Intergenic
1190997639 X:55625714-55625736 AAAACTCCACTGATGTCTCTTGG - Intergenic
1192017713 X:67349598-67349620 AAAAAGCAATTGATTCCTCACGG + Intergenic
1192497940 X:71628747-71628769 AAAATTCATCTGGAGTCTCACGG - Intergenic
1199599136 X:149531082-149531104 CAAATGCCACTCATGTCACAGGG - Intronic