ID: 1021705463

View in Genome Browser
Species Human (GRCh38)
Location 7:23363473-23363495
Sequence CTGGGATGATCCCTTGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3003
Summary {0: 1, 1: 0, 2: 12, 3: 228, 4: 2762}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021705463_1021705473 24 Left 1021705463 7:23363473-23363495 CCAGATTCAAGGGATCATCCCAG 0: 1
1: 0
2: 12
3: 228
4: 2762
Right 1021705473 7:23363520-23363542 TACAGGCGTGACCCAGCACCTGG 0: 1
1: 2
2: 41
3: 272
4: 694
1021705463_1021705474 29 Left 1021705463 7:23363473-23363495 CCAGATTCAAGGGATCATCCCAG 0: 1
1: 0
2: 12
3: 228
4: 2762
Right 1021705474 7:23363525-23363547 GCGTGACCCAGCACCTGGCCTGG 0: 1
1: 0
2: 2
3: 33
4: 286
1021705463_1021705469 7 Left 1021705463 7:23363473-23363495 CCAGATTCAAGGGATCATCCCAG 0: 1
1: 0
2: 12
3: 228
4: 2762
Right 1021705469 7:23363503-23363525 TCCCCAAGTGCTGAGATTACAGG 0: 117
1: 18963
2: 314663
3: 260222
4: 154417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021705463 Original CRISPR CTGGGATGATCCCTTGAATC TGG (reversed) Intronic
Too many off-targets to display for this crispr