ID: 1021706001

View in Genome Browser
Species Human (GRCh38)
Location 7:23368512-23368534
Sequence CTGAGGAAAGTGAAAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 0, 2: 1, 3: 59, 4: 455}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021705994_1021706001 30 Left 1021705994 7:23368459-23368481 CCAGAATAGGGAACTCTACGATA 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1021706001 7:23368512-23368534 CTGAGGAAAGTGAAAGTGGAGGG 0: 1
1: 0
2: 1
3: 59
4: 455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021706001 Original CRISPR CTGAGGAAAGTGAAAGTGGA GGG Intronic
900004816 1:37926-37948 CTGAGTAAAGTTGAAGGGGAGGG + Intergenic
902855261 1:19198709-19198731 CTGAGGAAAGTGCCACTAGAAGG + Intronic
902906011 1:19557868-19557890 GAAAGGAAAGTGAAAGGGGAAGG - Intergenic
903231980 1:21927536-21927558 CTGAGGGTAGTGACAGTGGGGGG - Intronic
903750686 1:25618406-25618428 CTGAGGCAAGGGAAAGGGGTGGG - Intronic
903896121 1:26606239-26606261 GTCAGGAAAGTGGGAGTGGAGGG + Intergenic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904001521 1:27341625-27341647 CTAAGGGAAGTGAAAGTGCCCGG - Intergenic
905018155 1:34791563-34791585 CTGAGGAAAGGGAAGGTGGCAGG - Intronic
906197856 1:43940150-43940172 CTGGGGATAGGGAAAGGGGATGG - Intergenic
906548457 1:46640117-46640139 ATGAGGAAAGTGAAAATATAAGG - Intronic
906838483 1:49109775-49109797 GTAAGAAAAATGAAAGTGGACGG - Intronic
907766117 1:57412212-57412234 CAGAGGAAGGGGAAAGTAGACGG - Intronic
907784213 1:57596061-57596083 TAAAGGACAGTGAAAGTGGAGGG - Intronic
908560769 1:65303922-65303944 CTGATCAAAGTGAAAGCTGAAGG - Intronic
909016238 1:70382813-70382835 CAGAGGCAACTGTAAGTGGAAGG - Intronic
909393775 1:75146259-75146281 CAGAGGAGAGTTAAAATGGAAGG + Intronic
909610178 1:77543186-77543208 CTGAGGAAAGTGGAAGCAGAAGG + Intronic
911380342 1:97106408-97106430 CTGAGTAAAGAGAATGTGGGCGG + Intronic
911511849 1:98816724-98816746 CTGATGAAAGAGAACTTGGAAGG - Intergenic
913159275 1:116130585-116130607 TTGAGGAAAGTGGAAGAGGTTGG + Intronic
913325264 1:117622828-117622850 CTGGGGAAACTGAAAGTGAGGGG - Exonic
914912661 1:151800087-151800109 GTGAGGAAAGTGAAGGTGGGAGG + Intergenic
915165542 1:153946150-153946172 CCTGGGGAAGTGAAAGTGGAGGG - Intronic
915623409 1:157099606-157099628 GGGAGGACAGTGAAAGAGGAAGG + Exonic
916578013 1:166084387-166084409 ATGAGGAAACTGAAGGTGAAAGG - Intronic
917495991 1:175540691-175540713 CTGGGGAAGGGGAGAGTGGATGG - Intronic
919470588 1:197974292-197974314 CTGAGGGCAGGGAAAGTAGAAGG + Intergenic
920938534 1:210458630-210458652 GTGAGCAAAGAGAAAGTGAAGGG + Intronic
921608160 1:217179104-217179126 GTGGGGAATGTGAAACTGGAAGG - Intergenic
922300947 1:224300244-224300266 TTGAGGAAAGTAAAAGTGAGTGG + Intronic
922497896 1:226074699-226074721 CAGAGGAGAGTAACAGTGGATGG - Intergenic
922740091 1:228009671-228009693 CACATGAAAGTGAAAGTGAAGGG + Intronic
922824686 1:228509681-228509703 GTGAGGGAAGTCAAAGTGAAGGG + Intergenic
922976876 1:229792452-229792474 CTGAGGACAGTGCAGGTGAATGG + Intergenic
923746820 1:236708878-236708900 CTGACTAAAGTGGAAGAGGAAGG - Intronic
1063696515 10:8340738-8340760 CTTAAGAAAGTGGGAGTGGATGG - Intergenic
1063768380 10:9169168-9169190 GTGGGGAAAGGGAAAGTGGGAGG + Intergenic
1066986590 10:42474133-42474155 CAGAGGAATGTGAAAGTCGTTGG + Intergenic
1067076432 10:43188067-43188089 CTGAGAAAAGTGAAATTACATGG - Intergenic
1067664650 10:48266753-48266775 CAGAGGAAAGTGGAAGTCTAGGG - Intronic
1069763827 10:70836569-70836591 CTCAGGAAAGGGAAAGGGAAAGG - Intronic
1069906888 10:71737273-71737295 CTGAGCAAACAGAAAGTGAAGGG - Intronic
1070430997 10:76337500-76337522 CTGAGGAAGGAGCAAGTGCAAGG + Intronic
1070627696 10:78062919-78062941 CTGAGCAGACTGAAAGTGGTGGG - Intergenic
1070660252 10:78300585-78300607 CTGGGGAAACAGAAAGTGAAGGG - Intergenic
1070921968 10:80193359-80193381 CTGGAGAAAGGGAAAGAGGAAGG + Intronic
1071106887 10:82108493-82108515 CTAAGGAAAGAGGAAGTGAAGGG - Intronic
1071668079 10:87579678-87579700 CTGAAGAAAGTGAACGTGGTAGG + Intergenic
1072766445 10:98098441-98098463 CTGAGGAGAGTGAGAGTGGTGGG - Intergenic
1073012397 10:100371588-100371610 GAGAGGAAAGTGGAAGTGAAAGG + Intergenic
1073537671 10:104292399-104292421 CTTTGGAAGGTCAAAGTGGAAGG - Intronic
1074139710 10:110661226-110661248 TTCAGGAAACTGAAAGTGGAAGG + Intronic
1075580685 10:123615798-123615820 GGGAGGAAAGTGGAAGAGGATGG - Intergenic
1076030137 10:127150336-127150358 CTGAGCAAAGAGAAAGGGGAGGG - Intronic
1076574849 10:131457760-131457782 CAGTGGAAGATGAAAGTGGATGG + Intergenic
1077810538 11:5632232-5632254 CTGAGAAGATTGAAAGGGGATGG - Intronic
1078500214 11:11866332-11866354 CTCAGGAGAGGGAAAGTGGTAGG + Intronic
1078781263 11:14441400-14441422 CTAAGAAAAGAAAAAGTGGATGG + Intergenic
1079278056 11:19060114-19060136 CAAAGGCAAGTGATAGTGGAGGG - Intronic
1079846355 11:25474779-25474801 CTGAGGAAAGTGAATGTAAATGG - Intergenic
1079893905 11:26094403-26094425 CTGAGGAACATGAAGGTAGAAGG - Intergenic
1080229174 11:29998974-29998996 CACTGGAAAGTGAAAATGGAAGG - Intergenic
1080290297 11:30663615-30663637 ATGACGAAAGTGAAAGCTGAAGG + Intergenic
1080597975 11:33792486-33792508 CAGAGGAAAGAGAACGTGAAAGG + Intergenic
1081020081 11:37935194-37935216 ATGAGGAAAGTGAAAGTCAGAGG + Intergenic
1081492001 11:43576548-43576570 GGGAGGAAAGAGAAAGTGGATGG - Intronic
1081797529 11:45831722-45831744 CTGAAGAAAATGAAACAGGATGG + Intergenic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1083190708 11:61050075-61050097 CAGAGGAAACTGGAAGGGGAAGG - Intergenic
1083402450 11:62433304-62433326 AAGAGGAAAGAGAAAGGGGAGGG + Intergenic
1083709335 11:64538667-64538689 GTGAGGATAGTGACAGTGAAGGG - Intergenic
1084493925 11:69492918-69492940 CTGAAAAAAGAGAAAGTGGCTGG + Intergenic
1086450321 11:86909212-86909234 CTAAGGAAGGTGACAGTGGGTGG - Intronic
1086984742 11:93235678-93235700 TTGAGGAAAATGGAAGTGAAAGG + Intergenic
1088392462 11:109329889-109329911 CTGAAGAAACTGAAAGTTGCTGG - Intergenic
1088976849 11:114823362-114823384 CTGAGGAAGGTGAAGCTGGCCGG - Intergenic
1089967682 11:122666866-122666888 ATGAGGAGAGTGAGAGAGGAGGG - Intronic
1090642754 11:128743462-128743484 CTGAGGAAAATGGAACTGAACGG + Intronic
1090866900 11:130709423-130709445 CTGGGGAAAATGTAAATGGATGG + Intronic
1090936076 11:131343748-131343770 CTGAGTAAAGAGAAGTTGGAAGG + Intergenic
1091192619 11:133707487-133707509 GGGAGGGAAGGGAAAGTGGAGGG + Intergenic
1091378227 12:39977-39999 CTGAGTAAAGTTGAAGGGGAGGG + Intergenic
1091580567 12:1785936-1785958 CTGATGAGAGTGAAACTGGAGGG - Exonic
1092436933 12:8456162-8456184 CAGAGGAAAGTGGAAGTGTATGG + Intronic
1092654324 12:10668730-10668752 CTGGAGAAAGTGAAAGTAGAAGG - Intronic
1092721392 12:11444464-11444486 AGGAGGAAAGTGGAAGTGAAGGG - Intronic
1093750955 12:22799628-22799650 AAGAGGGAAGTGAAAGGGGAAGG - Intergenic
1095114813 12:38340675-38340697 CTCAGGAAAGTGAAGTAGGAAGG - Intergenic
1095275146 12:40273128-40273150 TTGTGCAAAGTGAAATTGGAAGG - Intronic
1095972945 12:47916818-47916840 CTGTGGAAAGGGAAAGAGCATGG + Intronic
1096063738 12:48723517-48723539 CTAAGGAAAGTCAAAGAGCAAGG + Intergenic
1098152153 12:67557830-67557852 CTGAGGAATGGGAAATAGGAAGG - Intergenic
1099650122 12:85415906-85415928 CTGAGGAAAATCAAGGTGGAAGG + Intergenic
1100406757 12:94278640-94278662 CTGAGGATGTTGAAAGCGGAGGG + Intronic
1100490341 12:95072840-95072862 GAGAGAAAAGTGAAAGTGGGGGG + Intronic
1102984453 12:117266996-117267018 CTGAGGAATGTCAAAGGGAAGGG - Intronic
1103478903 12:121238255-121238277 CAGAGGAAATGGGAAGTGGATGG + Exonic
1105784853 13:23738556-23738578 CTGAGGAAGGCGGAGGTGGAAGG - Intronic
1106720487 13:32430127-32430149 CAGAGGGAAATGGAAGTGGACGG - Intergenic
1107759744 13:43665184-43665206 CTGAGAAGAGTGAAAGTCCAGGG - Intronic
1108853558 13:54765636-54765658 AGGAGGAAAGTGGAAGTGGAGGG + Intergenic
1109267703 13:60219988-60220010 TTGGAGAAAGTGAAAGTGAAGGG + Intergenic
1109902964 13:68797508-68797530 CTGACGTAAGTGAAAGGTGATGG - Intergenic
1110188399 13:72701624-72701646 CTGATGAAAGTGACAATGCAGGG + Intergenic
1110239232 13:73248334-73248356 CTGAGGAAAGTGATCTGGGATGG + Intergenic
1112021505 13:95375104-95375126 CTGAAGAAAGTAAAATTGGGTGG - Intergenic
1112155073 13:96808323-96808345 TTCAGGAGAGTGAAAGTGGTAGG + Intronic
1115378709 14:32708813-32708835 CTGAGGAAAGCTAAGGAGGAAGG - Intronic
1116109309 14:40556315-40556337 CTGAGGAAATTAAAAGAGGTAGG - Intergenic
1116287905 14:42996418-42996440 CTGAGGAAAGGGAAAGGGAAAGG - Intergenic
1116627266 14:47281607-47281629 TTGAGGAAATTAAAAATGGATGG - Intronic
1117191170 14:53293330-53293352 CTGAGCAAATTGACAGTGGCTGG - Intergenic
1118019304 14:61695203-61695225 CGGAGGAAAGAGAAAGGAGATGG - Intergenic
1118617454 14:67584120-67584142 CTCAGGTAAGTGCCAGTGGAAGG + Exonic
1118682728 14:68260055-68260077 CTAAGGAAAGTGATAATGGGGGG + Intronic
1118913270 14:70079686-70079708 CTGAGGAAAATGAAGGGGGAGGG - Intronic
1119660788 14:76450306-76450328 GTGAGCAAAGGCAAAGTGGAAGG + Intronic
1119938591 14:78616452-78616474 AAGAGGAAAGAGAAAGTAGAAGG - Intronic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1120673481 14:87391329-87391351 CTGAGGAAAGTGAAGTTAAACGG - Intergenic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1121083099 14:91124534-91124556 CTGAAGAAAGTGCTGGTGGAAGG + Intronic
1121567759 14:94923508-94923530 CTGTGGGCAGTGAAGGTGGAGGG - Intergenic
1121593309 14:95137321-95137343 AAGAGGAAAGGGAAAGGGGAAGG + Intronic
1122045847 14:99022758-99022780 ATGAGGAAACTGAAATTAGAAGG - Intergenic
1122378463 14:101285260-101285282 CTGAGGCAACTGAAGGTGGTTGG - Intergenic
1122822728 14:104355289-104355311 CTGTGCAAGGTGACAGTGGACGG - Intergenic
1122832065 14:104403222-104403244 CTGATGAAAGGCAAAGGGGAAGG - Intergenic
1123164262 14:106310453-106310475 CTGAGGAAAGCGTAAATGTAAGG + Intergenic
1123204217 14:106696158-106696180 CTGAGGAAAGTGTAAATGTAAGG + Intergenic
1123209226 14:106742626-106742648 CTGAGGAAAGTGTAAATGTAAGG + Intergenic
1125365107 15:38905177-38905199 CTGATGAAAGAGAAACTGAATGG - Intergenic
1125768117 15:42148517-42148539 CTGGGGAAAGGGGAGGTGGAGGG - Intronic
1126885727 15:53147771-53147793 TTGAGGAAAGAGAAAGAGTAAGG + Intergenic
1127857332 15:62963245-62963267 CTCAGGAAAGGGAAGGTAGAGGG - Intergenic
1128502546 15:68237377-68237399 CTGAGGAAGCTGAAGCTGGAGGG + Intronic
1129815856 15:78553127-78553149 CGGAGGACAGAGAAAGAGGAAGG + Intergenic
1131177240 15:90217744-90217766 CTGGGGAATGAGAAAGGGGAAGG - Intronic
1131523303 15:93133127-93133149 ATGCGGAAAGGGAAATTGGAGGG - Intergenic
1131593536 15:93773808-93773830 CTGAGGATAAGGAAAGTGTAGGG - Intergenic
1131789551 15:95949227-95949249 AGGAGGAAAGTGAAGGTGCATGG + Intergenic
1132014986 15:98307572-98307594 AAGAGGAAGGTGGAAGTGGATGG + Intergenic
1132448694 15:101953018-101953040 CTGAGTAAAGTTGAAGGGGAGGG - Intergenic
1133713584 16:8426061-8426083 CTGAATAAAGTGAAAGTAAATGG - Intergenic
1133938001 16:10284292-10284314 CTCAGGAAAGTGAGAAGGGATGG - Intergenic
1133960829 16:10492078-10492100 CTGGGGGAAGAGACAGTGGAAGG - Intergenic
1134362690 16:13546276-13546298 CTGAGGAAAATGAAATGGAAGGG - Intergenic
1136165012 16:28447970-28447992 CTGTGGAAAGTGAGAGAGGAAGG - Intergenic
1136197955 16:28667010-28667032 CTGTGGAAAGTGGGAGAGGAAGG + Intergenic
1136214300 16:28781187-28781209 CTGTGGAAAGTGAGAGAGGAAGG + Intergenic
1136259022 16:29061032-29061054 CTGTGGAAAGTGGGAGAGGAAGG + Intergenic
1136463998 16:30429679-30429701 CTGAGGCAAGGGAAATTGGGTGG - Intronic
1136689465 16:32018586-32018608 CTTTGGAAGGTGGAAGTGGAAGG + Intergenic
1136694144 16:32061730-32061752 CTGAGGAAAGAGTAAATGTAAGG - Intergenic
1136790054 16:32962128-32962150 CTTTGGAAGGTGGAAGTGGAAGG + Intergenic
1136794640 16:33004994-33005016 CTGAGGAAAGAGTAAATGTAAGG - Intergenic
1136871913 16:33815337-33815359 CTGAGGAAAGAGTAAATGTAAGG - Intergenic
1136875270 16:33849398-33849420 CTGAGGAAAGAGTAAATGTAAGG + Intergenic
1136879759 16:33891808-33891830 CTTTGGAAGGTGGAAGTGGAAGG - Intergenic
1137831840 16:51551247-51551269 CTGAGGAAGGTGTGAGAGGACGG - Intergenic
1138204881 16:55117321-55117343 CTGATGGAAGTGGGAGTGGAGGG - Intergenic
1138482658 16:57314068-57314090 CTGAGGAAAGGGAATGAGAAGGG + Intergenic
1139482068 16:67236202-67236224 ACGAGGAAACTGGAAGTGGAGGG + Intronic
1140995294 16:80253082-80253104 CTGAGGAAAGTGAGAGTCAAAGG - Intergenic
1141621898 16:85240728-85240750 CTGAGCAGAGTGACAGTTGAGGG + Intergenic
1142267673 16:89071955-89071977 CTGAGGAAAGTGGAATGGGCAGG - Intergenic
1203092258 16_KI270728v1_random:1223591-1223613 CTTTGGAAGGTGGAAGTGGAAGG + Intergenic
1203096903 16_KI270728v1_random:1266644-1266666 CTGAGGAAAGAGTAAATGTAAGG - Intergenic
1203100259 16_KI270728v1_random:1300731-1300753 CTGAGGAAAGAGTAAATGTAAGG + Intergenic
1142764216 17:2056575-2056597 CTGAGGGAAGGGGAAGTGGAGGG + Intronic
1142784584 17:2210585-2210607 ATGGGGAAAGAGAAAGAGGAGGG + Intronic
1143240512 17:5439430-5439452 TAGAGGAAAGTGACCGTGGAAGG - Intronic
1143397593 17:6614706-6614728 CTGAGGAAAGTGAAACCAGATGG - Intronic
1143579746 17:7818583-7818605 ATGAGGAAGGTGAAGGTCGAAGG + Intronic
1143887493 17:10076086-10076108 AAGAGGGAAGGGAAAGTGGAGGG + Intronic
1144028313 17:11297867-11297889 AGGAGGAAAGAGAAAATGGATGG + Intronic
1144637255 17:16918212-16918234 CTGAGAACATTGCAAGTGGATGG + Intergenic
1146029017 17:29348197-29348219 AGGAGGAAAGTGAAAGAGAAAGG - Intergenic
1146724941 17:35148950-35148972 CTGAGGAAAGGGGAAGGAGAAGG - Intronic
1146886357 17:36473572-36473594 CTGAGGATGGTGAAAGTAGTTGG + Intergenic
1147035748 17:37679123-37679145 CAGAGAAACGTGAAAGAGGAGGG - Intergenic
1147335233 17:39723610-39723632 CTGAGGAAGGTGAAGGTGCTTGG + Exonic
1147746415 17:42697486-42697508 CTGTGGACAGTGAGAGTGGCAGG + Intronic
1147849679 17:43432237-43432259 ATTAGGAAAGTGAGAGAGGAAGG - Intergenic
1147985236 17:44302765-44302787 CTGAGGCAAGAGAATCTGGAAGG + Intergenic
1148256098 17:46133716-46133738 TTCAGGTAACTGAAAGTGGAGGG + Intronic
1148791487 17:50175689-50175711 CTGTGGGAAGAGAGAGTGGAGGG - Intronic
1149341331 17:55689261-55689283 ATGAAGGAACTGAAAGTGGATGG - Intergenic
1151464405 17:74275279-74275301 CCAAGGAAAGTGAAGGTTGAGGG - Intronic
1152779223 17:82219065-82219087 CTAAGGACCGTGAGAGTGGATGG + Intergenic
1153059637 18:982008-982030 GTGGGGAGAGAGAAAGTGGAAGG - Intergenic
1153631699 18:7076702-7076724 CTGGGAAAATTGAATGTGGATGG + Intronic
1153971338 18:10229778-10229800 CTGAGGAAAGCAGAAGTGGAGGG - Intergenic
1154494579 18:14946112-14946134 CTCAGGAAAGTTAAAGAGGTAGG - Intergenic
1155326163 18:24666963-24666985 GAGAGGAAAGAGAAAGGGGAAGG - Intergenic
1155691651 18:28632156-28632178 CTTGAGAAAGTGAGAGTGGATGG + Intergenic
1156049519 18:32915366-32915388 CTTTGGAAGGTGAAAGTGTAGGG + Intergenic
1156472271 18:37384661-37384683 CAGAGCAAAGTGAAGGTGGTAGG + Intronic
1156478602 18:37422105-37422127 GTGAGGAAACTGAATGTGGTGGG + Intronic
1156641362 18:39104167-39104189 CTGAGGCTGTTGAAAGTGGAGGG + Intergenic
1156764565 18:40636263-40636285 GTGAGGAAACTGTAAGAGGAAGG - Intergenic
1156835794 18:41553110-41553132 CTGAGGCAAGTGAAAGAGCTAGG - Intergenic
1157024961 18:43831546-43831568 CAGAGGAAAGTGAAATTAAATGG + Intergenic
1157087889 18:44600345-44600367 GTGATGAAAGTGAAAGCTGAGGG + Intergenic
1157112347 18:44833015-44833037 CTGGGGACAGTGGAGGTGGATGG + Intronic
1157395933 18:47341038-47341060 GTGCTGAAAGTGAAAGTGAATGG - Intergenic
1157595019 18:48859182-48859204 ATGAGGACAGGGAGAGTGGAAGG - Intronic
1158188126 18:54795155-54795177 CTCAGGCATGTGACAGTGGATGG - Intronic
1158198792 18:54917118-54917140 CTGAGGAAAGGGGAAGTGAATGG + Intronic
1158757324 18:60341626-60341648 CTGAGGAAAGGGAGAGAGGCTGG - Intergenic
1159069436 18:63606751-63606773 CTGAGGAAAGACAGAGTGGCTGG + Intergenic
1159655600 18:71028097-71028119 AGGAGGAAAGTGAGAGTGGAAGG - Intergenic
1159882894 18:73876359-73876381 CTCAGAAAAGTGATGGTGGAGGG - Intergenic
1160636568 19:79535-79557 CTGAGTAAAGTTGAAGGGGAGGG + Intergenic
1161110897 19:2469457-2469479 CTGAGGACAGTGGCAGGGGAGGG - Intergenic
1162283493 19:9719520-9719542 CTGAGGGAAGAGAGAGTGGAAGG - Intergenic
1164565993 19:29326519-29326541 CTGAGGAAAGTGGGAGTTAATGG - Intergenic
1166885916 19:45960895-45960917 CTAAGGACAGTGACAGTGGTGGG - Intronic
1167566617 19:50261255-50261277 ATGAGGAGAGTGATAGGGGAGGG - Intronic
1167703012 19:51061680-51061702 CGGAGGGATGTAAAAGTGGAAGG - Intronic
1168051035 19:53830153-53830175 CTGATGAAAGTGACTGTGGCTGG - Intergenic
1168167559 19:54561840-54561862 CAGAGGAAAGTGAAAGCAGAGGG + Intergenic
1168426820 19:56245706-56245728 TTGAGGAAACTGAATGGGGAAGG - Intronic
925738586 2:6985552-6985574 CTTAGGAAGGTGGATGTGGAAGG + Intronic
926165602 2:10520914-10520936 CTGAGGACGGTGAATGTAGACGG + Intergenic
926261223 2:11264308-11264330 GTGATGACAGTAAAAGTGGATGG + Intronic
926321215 2:11749445-11749467 CTGTGGAAAGAGGAAGAGGAAGG - Intronic
927093814 2:19732506-19732528 CTGAGGAAAGTGAAAATCAGAGG + Intergenic
927250262 2:20990184-20990206 AAGAGGAAAGGGAAAGAGGATGG - Intergenic
927620717 2:24654965-24654987 CTTAGGTATGTGGAAGTGGAAGG - Intronic
929837445 2:45418434-45418456 CTGAAGAAAGTGAAAGGGCTGGG - Exonic
929991569 2:46793904-46793926 CTGTTGAAACTGAAAGGGGAGGG + Intergenic
930907018 2:56582215-56582237 CAGAGGAAACTGAATTTGGATGG + Intergenic
930960859 2:57260067-57260089 CTGAGCAAAATGAAAATGTAGGG + Intergenic
931242950 2:60468530-60468552 GTGAGGAAAGAAAAAGGGGAGGG + Intronic
931398546 2:61909725-61909747 GTGAAGAAAGTGAAAATGAAGGG + Intronic
931982525 2:67709682-67709704 CTAAGGAAACTGAAAATGAAAGG - Intergenic
932055056 2:68434936-68434958 CAGAGGAAACTGCAAGTGCACGG + Intergenic
932150473 2:69366662-69366684 CTGAGTAAAGTGGAAATTGAGGG - Intronic
932750256 2:74366936-74366958 CTCAGGAAAAAGAAAATGGATGG + Intronic
933366058 2:81355568-81355590 CTGCTGAAAGTGAAAGTAGGAGG + Intergenic
935098661 2:99971211-99971233 GTGAGGAAAGAGGAACTGGACGG - Intronic
935253064 2:101282586-101282608 AGGAAGACAGTGAAAGTGGAGGG + Intronic
936454908 2:112665584-112665606 CTGAGCCAAGTGAAAGTGCCAGG - Intergenic
936564912 2:113575505-113575527 CTGAGTAAAGTTGAAGGGGAGGG - Intergenic
936852084 2:116912494-116912516 CAGATGGAAGAGAAAGTGGAAGG + Intergenic
937040957 2:118820294-118820316 CAGAGGAAAGTGAGTGTGGGAGG + Intergenic
937175754 2:119932772-119932794 TTGAGGAGAGTGAGAGTGGAGGG - Intronic
938089944 2:128424869-128424891 CAGAGGAAGTTGATAGTGGAAGG + Intergenic
939144257 2:138393906-138393928 CAGAGGAAGGTGAATGCGGAAGG - Intergenic
939827280 2:147029998-147030020 CTGAGAAAATTGAAAATTGAGGG + Intergenic
939830655 2:147066448-147066470 CTGAGGTTAAGGAAAGTGGAAGG - Intergenic
940210431 2:151251219-151251241 CTGAGTCAGGAGAAAGTGGATGG - Exonic
941513190 2:166438780-166438802 CTGAGGAAAATTAAGCTGGAAGG + Intronic
941760650 2:169238925-169238947 AAGGGGAAAGAGAAAGTGGAGGG - Intronic
941949285 2:171136474-171136496 CTGAGGCAAGTGAACCTGGGAGG + Intronic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
943398714 2:187376168-187376190 CTCAGGAAAGTTGAAGTAGATGG - Intronic
945990093 2:216388783-216388805 CCTAGCAAAGTGAAAGTGGGAGG - Intergenic
946435971 2:219654281-219654303 CTTAGGAAAATAGAAGTGGAGGG + Intergenic
947068906 2:226263785-226263807 CTGCTGTAAGTAAAAGTGGAAGG + Intergenic
947255053 2:228154109-228154131 GTGAGAAAAGAGAAAGTAGATGG - Intronic
948241778 2:236443812-236443834 CAGAGAAAAGGGAATGTGGAAGG - Intronic
948363906 2:237442292-237442314 ATGAGGAGAGTGAAAATGGCTGG - Intergenic
948935056 2:241158535-241158557 CTGAAGAAAGTGAAGGTGAGAGG + Exonic
948990288 2:241550632-241550654 CTGGGAAAAGTGAATGGGGAGGG + Intergenic
1169257482 20:4110245-4110267 CTGTGCAAAATGAAAATGGAGGG + Intergenic
1169417678 20:5431873-5431895 CTGAGGCATGGGACAGTGGAGGG - Intergenic
1170237780 20:14126871-14126893 CTGAGGACAGGGAAAGAGGCTGG - Intronic
1170386983 20:15830089-15830111 CTCATGAAAGTGCAAGTGGTGGG + Intronic
1170602280 20:17849914-17849936 CTGAGGAAAATGTGAGTGTATGG - Intergenic
1171070482 20:22063279-22063301 GTGAAAAAAGTGAAGGTGGATGG - Intergenic
1172603726 20:36200830-36200852 CAGAGGAAAGGGAAAGAGGGAGG - Intronic
1172791201 20:37506673-37506695 CAGAGGAAAATGAAAGGGCAAGG - Intronic
1173224043 20:41151548-41151570 CAAAGGAAGGTCAAAGTGGAGGG - Intronic
1173468042 20:43299978-43300000 CAGAGCCATGTGAAAGTGGAAGG + Intergenic
1173501358 20:43556445-43556467 CTGAGGAATGTCAAAGTGAAGGG + Intronic
1174008328 20:47428266-47428288 CAGAGGGAAGGGAAGGTGGACGG - Intergenic
1174169363 20:48606597-48606619 CTGCAGAAAGCGACAGTGGACGG + Intergenic
1175051655 20:56161135-56161157 CAGAGGAAAGAGCAAGTGCAAGG - Intergenic
1175164808 20:57035916-57035938 CTGAGGCAAGTGAGAGTGAGAGG - Intergenic
1175289797 20:57868147-57868169 GTGAGGAAGGTGAGAGGGGAAGG - Intergenic
1175300529 20:57939803-57939825 ATGTGGACAGGGAAAGTGGAGGG - Intergenic
1175433863 20:58928669-58928691 ATTAGGAAAGTCAAAATGGAAGG + Intergenic
1176074523 20:63242390-63242412 GTTAGAAAAGTGAGAGTGGATGG + Intronic
1177393905 21:20509322-20509344 CTGAGGAAAGTGAAGGACAAAGG - Intergenic
1177637363 21:23804867-23804889 AAGAGCAGAGTGAAAGTGGAAGG - Intergenic
1177895838 21:26855412-26855434 CCAAGAAAATTGAAAGTGGAAGG - Intergenic
1178013369 21:28313453-28313475 CTGGGGCTAGGGAAAGTGGAAGG - Intergenic
1178304436 21:31479686-31479708 CTGAAGGAAGTGAAAAAGGAAGG + Intronic
1178436942 21:32567929-32567951 CTGAGGAAAGGGTAAGTGAAGGG - Intergenic
1178717393 21:34978418-34978440 CTGAGGACAGTAAAAATGAAAGG - Intronic
1178944708 21:36937166-36937188 CTGGGGACAGTGACAGGGGAGGG - Exonic
1179145950 21:38767577-38767599 CTGTGGAGTCTGAAAGTGGAGGG - Intergenic
1179678476 21:43001031-43001053 CAGATGGAAGTGAAATTGGAGGG + Intronic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186122 21:46140212-46140234 GTGAGGCACGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180748589 22:18109802-18109824 CTGAGGAAAGTGGAAGAGAGAGG + Intronic
1180887781 22:19259775-19259797 TAAAGGAAAGTGAAAGTGAAAGG + Intronic
1182810480 22:33111916-33111938 CTGAGGGAACAGACAGTGGAAGG + Intergenic
1182948117 22:34344163-34344185 CTGGGGACAGTGACAGTGGGTGG + Intergenic
1183346841 22:37312744-37312766 GTGAGGAAAGCCAAAGTGTAGGG + Intronic
1184307657 22:43617521-43617543 ATGAGGAAGGGGAAAATGGATGG - Intronic
949649602 3:6140964-6140986 CTGAGGGAAATAAAACTGGATGG - Intergenic
950616083 3:14159220-14159242 CTGAGGAAACTGAAACTCGGAGG - Intronic
953242215 3:41159742-41159764 TTGGAGAAAGTGAGAGTGGAAGG - Intergenic
953334264 3:42080513-42080535 TTAAGAAAAGTGAGAGTGGATGG - Intronic
953881181 3:46692232-46692254 ATGAGGAGAGTGTAAGTGCAGGG + Intronic
954761390 3:52877261-52877283 CTGAGGCATGTGAAGGTGGAGGG - Intronic
956585906 3:70864398-70864420 CTGAATAAATTGAAAGTGGCTGG + Intergenic
959498126 3:107074666-107074688 CTGAGGAAAGTGAGGATGCAGGG + Intergenic
959712034 3:109395141-109395163 CTGAGGAGAGAGAAAGTTAATGG + Intergenic
959995526 3:112676454-112676476 GAGAGGAAAGTGGAAGGGGAAGG + Intergenic
961871482 3:129991793-129991815 CTAAGGAGAGTGACAGTAGATGG - Intergenic
962159392 3:132982868-132982890 CTGAGGCATGGGAAAATGGAAGG + Intergenic
962196152 3:133365407-133365429 CTCAGGAAAGAGAAAAGGGAGGG + Intronic
964034644 3:152180956-152180978 TTGAGAAAAGTGAAAATAGATGG - Intergenic
965738856 3:171851596-171851618 CTGATGAAACTGTAAATGGAAGG - Intronic
967095661 3:186175298-186175320 CTGAGGCAAGAGAAAGTGTGAGG + Intronic
968091615 3:195901554-195901576 CTAAGGAAGGTGAGAGGGGAGGG - Intronic
968953320 4:3705906-3705928 CGGAGGAAAATGAAACAGGAAGG - Intergenic
969294943 4:6264202-6264224 CTCAGGAAAGAGGCAGTGGATGG + Intergenic
969847417 4:9930235-9930257 CTGATGAAAGTGATGGTGAAGGG - Intronic
969899570 4:10336391-10336413 CAGAGGAGAGTGAAAGGGGGTGG + Intergenic
970228639 4:13885858-13885880 CTGAGGCAATAGAATGTGGAAGG - Intergenic
970536781 4:17038139-17038161 CTGAGGAAAGAGAATGAGCATGG - Intergenic
970715829 4:18921540-18921562 CTGAAGAAAGTTAAAAAGGAAGG - Intergenic
970726228 4:19048227-19048249 CTTTGGAAAGCCAAAGTGGAAGG - Intergenic
971466542 4:26969276-26969298 TTGGGGAAAGTGGCAGTGGAGGG + Intronic
971987635 4:33846773-33846795 ATGAGGAAATTCAAAGAGGAGGG + Intergenic
972170304 4:36337185-36337207 AGGAGGAAAATGAAAGTGAAGGG + Intronic
972224587 4:36997711-36997733 CTTAGTAAAGTGAAACTAGAAGG + Intergenic
972413888 4:38819906-38819928 CACAGGAAAGAGACAGTGGATGG - Intronic
973754461 4:54060942-54060964 TTGAGGAAAGTGGTATTGGAAGG - Intronic
973816410 4:54623405-54623427 GTGAGGAAGGCGAGAGTGGAAGG - Intergenic
973831965 4:54770619-54770641 CTGAAGAAAGTGAAACTGCAGGG - Intergenic
974218756 4:58936912-58936934 CTGAGGAAAGAGAAAGAAGTAGG + Intergenic
975531115 4:75400317-75400339 CTGAGAACAGGGAAAGTGGTGGG - Intergenic
975870264 4:78772726-78772748 CTGAGGAAAGCGAAACTGTGGGG - Intergenic
976986250 4:91302690-91302712 CAGAGAAAAGGGAAAGTGGCTGG - Intronic
977125310 4:93158437-93158459 CTGGGGAAAGAGAAAGGAGAAGG + Intronic
977459644 4:97309086-97309108 ATGGGGAAAATGAAACTGGAGGG + Intronic
978257336 4:106708504-106708526 ATGAGGACAGTGAAAGTAAAAGG - Intergenic
978291885 4:107151784-107151806 CTGAGGAAAGTGAAAAACGGTGG + Intronic
978639462 4:110852580-110852602 TTTAGGAAAGTGTAAGTGGTTGG + Intergenic
978697231 4:111596866-111596888 ATGAGGAAAGTGAGAGATGACGG + Intergenic
979128762 4:117011910-117011932 TTGAGGAAAATGAAACAGGAGGG - Intergenic
979978770 4:127228641-127228663 TTGAGGAAAGTGAAAGAAGACGG + Intergenic
981995645 4:150971463-150971485 TTGAGGAAAGAGAAGGTGGCTGG - Intronic
982335382 4:154231287-154231309 AGGAGAAAAGTGAAAGAGGAAGG - Intergenic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
983124730 4:163936781-163936803 CTGAGGAAAATGAAAAGGCAGGG - Intronic
983423496 4:167551535-167551557 ATGAGGAAAGTGTGAGAGGATGG + Intergenic
984412786 4:179416090-179416112 CTAAGACATGTGAAAGTGGAAGG - Intergenic
984721354 4:182976114-182976136 CTGTGGAAAATAAAACTGGATGG + Intergenic
985913450 5:2900533-2900555 CTGGGGAGGGAGAAAGTGGAGGG - Intergenic
986585179 5:9309052-9309074 CAGAAGAAAGAGTAAGTGGAAGG + Intronic
987522536 5:19005466-19005488 GTGAGGAAAGTGAAATAGGAAGG + Intergenic
987533037 5:19145373-19145395 CGGAGGAAAATGAAAATGAATGG - Intergenic
988691906 5:33580919-33580941 CTAAGGAAAGTAGATGTGGATGG - Intronic
988735843 5:34020499-34020521 CTGAGGAACATTAAAGTTGAGGG - Exonic
989447246 5:41544727-41544749 CTGGGGAAAGTCAAAGTGTAAGG - Intergenic
990040631 5:51375137-51375159 CAGAGGAAAATGTAAGTGGATGG - Intergenic
991725747 5:69534026-69534048 ATAAGGAAAGTGAAAAGGGAAGG + Intronic
991869207 5:71093838-71093860 ATAAGGAAAGTGAAAAGGGAAGG - Intergenic
992579911 5:78162372-78162394 CTGAGGAAAAAGAATGTTGAAGG + Intronic
992666727 5:79017614-79017636 CTGAATAAAATGAAAGTGTATGG - Intronic
992721209 5:79563103-79563125 CTAAGGAAAGTGAAAGTTATAGG + Intergenic
994479729 5:100318672-100318694 CAGAGGAAAGTGAAAGAACAGGG + Intergenic
995214157 5:109575415-109575437 GTGAGCAAAGAGAAAGTAGATGG - Intergenic
995538722 5:113163478-113163500 AGGAGGAAAGAGAAAGTGGATGG - Intronic
995553191 5:113300542-113300564 CTGAAGAAAGTGAATTTTGAGGG + Intronic
995867363 5:116706055-116706077 TTGAGGGAAAGGAAAGTGGAAGG - Intergenic
995894586 5:116997736-116997758 CGGAAGACAGTGACAGTGGACGG + Intergenic
996016005 5:118534660-118534682 CTGGGGAAACGGGAAGTGGAGGG - Intergenic
996199459 5:120653133-120653155 GAGAGGAAAGTGACTGTGGAAGG + Intronic
996419325 5:123244328-123244350 CTAAGAAAAGTGAAAGTTAATGG - Intergenic
996464478 5:123783416-123783438 CTTGGGAAGGTGAAAGGGGAGGG + Intergenic
996523390 5:124451492-124451514 CTGAGGGAAGTGGAGATGGAAGG + Intergenic
999109016 5:149100140-149100162 TGGAGGAAAGAGAAAGTGAAAGG + Intergenic
999565293 5:152853208-152853230 CTAGGGAAAGTGAAACTTGATGG - Intergenic
999588316 5:153116086-153116108 GAGAGGAAAGTGAAGGTGAAAGG - Intergenic
1000443156 5:161286473-161286495 CTCAGGAAAGTGAAAGTATAAGG - Intergenic
1003215904 6:4111542-4111564 ATGAGTAGGGTGAAAGTGGAAGG - Intronic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1003752264 6:9072677-9072699 CTGAGGAAATTGAACATCGACGG - Intergenic
1004008583 6:11659176-11659198 CTGAAGAATGTCCAAGTGGAAGG + Intergenic
1004231618 6:13838859-13838881 ATGACGATAGTGACAGTGGAAGG - Intergenic
1004248994 6:14007046-14007068 GGGAGGAAAGGGAAAGGGGAGGG - Intergenic
1006285355 6:33089080-33089102 CAGGGGATGGTGAAAGTGGAAGG + Intergenic
1006319876 6:33314081-33314103 TGGAGGAAAGTGAAAGTGAAAGG - Exonic
1006536731 6:34705189-34705211 GGGAGGATATTGAAAGTGGAGGG - Intergenic
1006630617 6:35427487-35427509 CTGAGTAAAGGGGAAGGGGAGGG - Exonic
1008397474 6:51025523-51025545 CTGCGGAAAGTGAAACAGAATGG + Intergenic
1008593626 6:53018777-53018799 GAGAGAAAAGAGAAAGTGGAAGG + Intronic
1010317404 6:74467016-74467038 CTTAGAAAAGTGGAAGTGGAAGG - Intergenic
1011318962 6:86069213-86069235 GTGAGGAAAGTGAGAATAGAAGG - Intergenic
1011733525 6:90290766-90290788 CTGCAGAAAGTGACAGGGGAGGG + Intronic
1011791797 6:90906966-90906988 CTGTGGAAAGAGAAAGAGAAAGG - Intergenic
1011995214 6:93578124-93578146 CTGTGAAAAGTGAAAAAGGAAGG + Intergenic
1012094006 6:94934660-94934682 CTGAGGGAAGTCATGGTGGAGGG - Intergenic
1012649103 6:101730690-101730712 AAGAGACAAGTGAAAGTGGAAGG + Intronic
1012813103 6:103985895-103985917 CTGAGGAAAGTTAAGCAGGAGGG - Intergenic
1013059070 6:106614263-106614285 CTGAGGAAGGTGAAAGAGCAGGG + Intronic
1013509489 6:110831536-110831558 CTTCGGAAGGTGAAAGTGGGAGG - Intronic
1013851462 6:114521007-114521029 ATGAGTAAAGAGAAAGTGAATGG + Intergenic
1014001316 6:116369837-116369859 CTGAGGATAGAGGAATTGGATGG + Intronic
1015389705 6:132667827-132667849 CTGAAGAAAGGGGAGGTGGAAGG - Intergenic
1015968879 6:138723420-138723442 CTGAGGAAGTTGAAAGTAGATGG - Intergenic
1017352629 6:153459643-153459665 CTGAGGAAGGGGTAAGTGAAGGG - Intergenic
1018144870 6:160876801-160876823 CTGAGGAAGGGGTAAGTGAAAGG + Intergenic
1018968489 6:168508016-168508038 CTGAGGACCGTGACAGTGGCAGG - Intronic
1019410048 7:902653-902675 ATGAGAACAGGGAAAGTGGAGGG + Intronic
1020828129 7:13057916-13057938 CTGAGCAAAGTGAAAGAGAAAGG - Intergenic
1021051101 7:15986094-15986116 TGGAGGAAAATGAAAGTAGATGG + Intergenic
1021315559 7:19144268-19144290 CTGAGGAAAGGAAAAATGGAAGG - Intergenic
1021428698 7:20534678-20534700 CTTTGGAAAGTGCATGTGGATGG + Intergenic
1021706001 7:23368512-23368534 CTGAGGAAAGTGAAAGTGGAGGG + Intronic
1021828631 7:24580044-24580066 CTTAGGAAAGGAAAAGTGAAAGG + Intronic
1022556882 7:31306858-31306880 CTGTGGGAAGTGAATGTGGCTGG + Intergenic
1023073300 7:36458963-36458985 CTGTGTAAAGTGGGAGTGGAGGG + Intergenic
1023354795 7:39355950-39355972 CTCAGGAAGGTGCAAGTCGAAGG + Intronic
1023980639 7:45068073-45068095 CTGAGGCATGGGAAAGTGAAAGG - Intronic
1024226896 7:47332279-47332301 CGGAGGAAAGTAAAAATGCAAGG + Intronic
1024777396 7:52803509-52803531 CTGAGGATAAGGAAAGGGGATGG - Intergenic
1024814047 7:53247158-53247180 CTGAGGAAAGTGCACCTTGATGG - Intergenic
1025107026 7:56179830-56179852 CTGAGGCAGGAGAAAGTGGCAGG + Intergenic
1026311188 7:69186085-69186107 CTGAGGCAGGGGAAAGTGGCAGG - Intergenic
1028160508 7:87479416-87479438 CTTGTGAAAGTGAAAGGGGATGG - Intronic
1028242399 7:88437267-88437289 CTTGAGAAAGTGAAAGAGGATGG - Intergenic
1028617862 7:92790299-92790321 CTCAGGGAAGTGGCAGTGGATGG - Intronic
1028651659 7:93156907-93156929 CTGGGGAAAGTGAAACAGGGAGG - Intergenic
1030626783 7:111853624-111853646 CAGAGGAAAGCAACAGTGGAGGG + Intronic
1030699171 7:112619968-112619990 GTGAGGTAACTGAAAGTGGAGGG + Intergenic
1031541018 7:122994547-122994569 CTGAGGATTGTGAAAGGGAAAGG + Intergenic
1032227248 7:130042498-130042520 CTTTGGAAAGTAAAAATGGATGG - Intronic
1032400169 7:131619270-131619292 CTGAGGGAGGTGAAGGAGGATGG - Intergenic
1032583909 7:133129173-133129195 CTGGGGAAAGGGCATGTGGATGG + Intergenic
1032696888 7:134344881-134344903 CAGAAGAACGTGGAAGTGGAAGG - Intergenic
1033251123 7:139760675-139760697 CTAAGGAAAGTGAAAGCATAAGG + Intronic
1033361919 7:140643861-140643883 CTGGGAAAAGTGAAAGTGAGAGG + Intronic
1033628913 7:143138567-143138589 CTGAGGAAAGTGAGAGTGAGAGG + Intronic
1033921542 7:146398960-146398982 CAGAGGAAAGAGAAAGTTCAAGG - Intronic
1034026090 7:147706335-147706357 CCCAGACAAGTGAAAGTGGAAGG - Intronic
1034370903 7:150595477-150595499 AGGAGGAAAGGGAAAATGGATGG - Intergenic
1034466294 7:151232025-151232047 CTCAGGGAACTGAAAGTTGAGGG - Intergenic
1035127374 7:156618368-156618390 TTCAGGAAAGTGAAAATGGTTGG - Intergenic
1035352466 7:158256289-158256311 CTGAGGAAAGTGGACGTGGCAGG + Intronic
1036179157 8:6568209-6568231 CTGAGGACCGTGGAAGTGGGTGG + Intronic
1037322672 8:17658731-17658753 CTAAGGAACGTGAAAATGGCAGG + Intronic
1037547965 8:19941642-19941664 GTGAGTAGAGTGAAAGTGGAGGG - Intronic
1038207454 8:25480568-25480590 ATGAGGAAAGAGAAAGTTGATGG + Intronic
1039535048 8:38302576-38302598 CTGAGAATAATGTAAGTGGAGGG - Intronic
1042064523 8:64859172-64859194 CAGAGGAAAGTCAGACTGGAAGG - Intergenic
1042301242 8:67284883-67284905 CTGAGGAAAAGGGAAGTTGAAGG + Intronic
1042323720 8:67505969-67505991 ATAATGAAAGTGAAAGTCGAAGG - Intronic
1042776533 8:72438496-72438518 CTGAGGAAAGTGAAAACGTGGGG - Intergenic
1042781908 8:72500556-72500578 GAGAGGAAAGGGAAAGTGGGGGG + Intergenic
1043489526 8:80735007-80735029 CTGAGCAAATTGAAATTGGGGGG - Intronic
1044069636 8:87741289-87741311 GTGAGGAAAATGAAATTGAAAGG + Intergenic
1044268963 8:90217317-90217339 CTGAAGAAAGTGAGAATGGTTGG - Intergenic
1044681113 8:94778533-94778555 TTGAAGAAAGTGGAAGCGGAGGG - Intronic
1045314596 8:101032397-101032419 CAAAGGAAAGTAAGAGTGGAGGG - Intergenic
1045955324 8:107899054-107899076 ATAAGGAAACTGAGAGTGGAGGG + Intergenic
1046089568 8:109484608-109484630 CCGAGGAAAGTTAAAGGGCAAGG - Intronic
1047006048 8:120621451-120621473 GTGAGAAATGGGAAAGTGGAGGG + Intronic
1047905527 8:129468865-129468887 GTGAGAAAAGTGAAACTTGAAGG + Intergenic
1048027769 8:130602276-130602298 CTGAGGAAAATGGAAGGGGATGG - Intergenic
1048122616 8:131598802-131598824 CTGGGGACAGGGAAAGTGGTAGG - Intergenic
1049104174 8:140601104-140601126 CTGGGGAACTTGAGAGTGGAGGG - Intronic
1049887510 9:37708-37730 CTGAGTAAAGTTGAAGGGGAGGG + Intergenic
1051115007 9:13684685-13684707 CTGTGGAAAGTGACAAAGGAAGG - Intergenic
1051366355 9:16324150-16324172 CTGAGGAAAAAGGAAGGGGAGGG + Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051610325 9:18955745-18955767 CAGAGAAAAGTGAGAGTGGCAGG - Intronic
1052116163 9:24650466-24650488 CTCAGAAAAGTAAAAGTTGAAGG - Intergenic
1052136904 9:24923520-24923542 CTGAAAAAAGTGAAAATGGCTGG + Intergenic
1052629977 9:31025326-31025348 ATGAAGAAAGAGAAAGTAGAGGG + Intergenic
1052677508 9:31645841-31645863 CTGGGACAAGTAAAAGTGGAAGG + Intergenic
1052945380 9:34164256-34164278 CTGATGAAAGTGACATTGGAGGG - Intergenic
1055506039 9:76950413-76950435 CTAAGGAAAGAAAAAGTAGAAGG - Intergenic
1056201258 9:84279024-84279046 CTGAGAAAAGTCAGAGTGAAAGG + Intronic
1056965185 9:91159452-91159474 GAGAGGAAAGAGAAAGAGGAGGG + Intergenic
1058252290 9:102713805-102713827 CTTAGGACAGTGAAAATGAAAGG + Intergenic
1058546055 9:106060980-106061002 GTGGGAAAAGTGAAAGTGAATGG - Intergenic
1058888913 9:109344161-109344183 CTGAGGAAAGTGTCATTGGTTGG - Intergenic
1059147679 9:111916325-111916347 ATGGGGAAAGTGAAAGAGGATGG - Intronic
1059268144 9:113055335-113055357 CTGAAGTAAGTAAAAGAGGATGG - Intronic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059528932 9:115018046-115018068 CTGAGGAGAGTTAAAGGAGAGGG + Intergenic
1060187234 9:121571079-121571101 CTCAGGGAAGAGAAAGAGGAAGG - Intronic
1060580503 9:124741871-124741893 CTGAGGTCAGTGAAAGTGCTCGG + Intronic
1061004783 9:127922258-127922280 CTGAGAAAAGTGAAAGTGTTGGG + Intronic
1061465821 9:130778651-130778673 CTGGGGGATCTGAAAGTGGATGG - Intronic
1186648124 X:11529068-11529090 CTGAGAAAAGTAAAAGTAGATGG - Intronic
1187251557 X:17603087-17603109 CTTTGGAAGGTGAAAGTGGGAGG - Intronic
1188010968 X:25055501-25055523 CTGAGGATAGTGAGAATGGAGGG - Intergenic
1188965394 X:36545352-36545374 CTGGGGAAAATGAAAGTGTAGGG - Intergenic
1189238598 X:39507994-39508016 CTGAGGAACGTGGAAGTCAAGGG + Intergenic
1189564047 X:42221226-42221248 CTGAGGAAAGTTAAATGGGTTGG - Intergenic
1189697445 X:43679285-43679307 CTCAGGAAACTAAAAGGGGAGGG - Intronic
1189824670 X:44905953-44905975 CTGAGCAAAGTAAAAGAGAATGG - Intronic
1189842928 X:45101093-45101115 CTTAGGAAAATAAAAATGGATGG - Intronic
1189905176 X:45751759-45751781 CTGAGGAGAGGGAAACTTGATGG - Intergenic
1190975465 X:55396249-55396271 CTGAGGAAAATGATAGAAGACGG + Intergenic
1192615439 X:72616258-72616280 CTCAGGAAACTGAAGTTGGAGGG + Intronic
1193065063 X:77250624-77250646 CTGAGTACAGTGTTAGTGGAGGG - Intergenic
1196184082 X:112726720-112726742 TTGAGGAAAGGGAAAATGGAAGG - Intergenic
1196359824 X:114839755-114839777 CTGAGGAATTTGCAACTGGAAGG + Intronic
1198174534 X:134142447-134142469 CTGAGGAAAGTGAAAAGGTTTGG + Intergenic
1198952777 X:142091406-142091428 CTGAGGAAAGTCATAAAGGATGG - Intergenic
1201864766 Y:18637918-18637940 CTGAGGAAACTGCAAGTGCTGGG - Intergenic
1201868556 Y:18682460-18682482 CTGAGGAAACTGCAAGTGCTGGG + Intergenic