ID: 1021708656

View in Genome Browser
Species Human (GRCh38)
Location 7:23393525-23393547
Sequence CCGTGCCCCCAAAGGGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021708651_1021708656 0 Left 1021708651 7:23393502-23393524 CCCTACTCTAAGGGGCTCGGAAA 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1021708656 7:23393525-23393547 CCGTGCCCCCAAAGGGAAACAGG No data
1021708646_1021708656 30 Left 1021708646 7:23393472-23393494 CCTGTAGCAAGTACTATGCTCAA 0: 1
1: 0
2: 1
3: 10
4: 92
Right 1021708656 7:23393525-23393547 CCGTGCCCCCAAAGGGAAACAGG No data
1021708652_1021708656 -1 Left 1021708652 7:23393503-23393525 CCTACTCTAAGGGGCTCGGAAAC 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1021708656 7:23393525-23393547 CCGTGCCCCCAAAGGGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021708656 Original CRISPR CCGTGCCCCCAAAGGGAAAC AGG Intronic
No off target data available for this crispr