ID: 1021717318

View in Genome Browser
Species Human (GRCh38)
Location 7:23471307-23471329
Sequence CCTGCGCTCGCGGTGGCTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021717310_1021717318 -8 Left 1021717310 7:23471292-23471314 CCTCCTCCGCCTCCGCCTGCGCT No data
Right 1021717318 7:23471307-23471329 CCTGCGCTCGCGGTGGCTCTCGG No data
1021717306_1021717318 24 Left 1021717306 7:23471260-23471282 CCGCAGCGTCCTGGGCGGGTGTC No data
Right 1021717318 7:23471307-23471329 CCTGCGCTCGCGGTGGCTCTCGG No data
1021717309_1021717318 15 Left 1021717309 7:23471269-23471291 CCTGGGCGGGTGTCTGGGCGACA No data
Right 1021717318 7:23471307-23471329 CCTGCGCTCGCGGTGGCTCTCGG No data
1021717305_1021717318 25 Left 1021717305 7:23471259-23471281 CCCGCAGCGTCCTGGGCGGGTGT No data
Right 1021717318 7:23471307-23471329 CCTGCGCTCGCGGTGGCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021717318 Original CRISPR CCTGCGCTCGCGGTGGCTCT CGG Intergenic
No off target data available for this crispr