ID: 1021717708

View in Genome Browser
Species Human (GRCh38)
Location 7:23474317-23474339
Sequence GCTCCCGCGCTCCCCGGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021717698_1021717708 14 Left 1021717698 7:23474280-23474302 CCGCGAGACTGGCGCGCAAAAGC No data
Right 1021717708 7:23474317-23474339 GCTCCCGCGCTCCCCGGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021717708 Original CRISPR GCTCCCGCGCTCCCCGGGGC CGG Intergenic
No off target data available for this crispr