ID: 1021717709

View in Genome Browser
Species Human (GRCh38)
Location 7:23474320-23474342
Sequence AAGCCGGCCCCGGGGAGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021717709_1021717716 1 Left 1021717709 7:23474320-23474342 CCCGCGCTCCCCGGGGCCGGCTT No data
Right 1021717716 7:23474344-23474366 CCGAGTCCAAGTTGAGCAACCGG No data
1021717709_1021717719 30 Left 1021717709 7:23474320-23474342 CCCGCGCTCCCCGGGGCCGGCTT No data
Right 1021717719 7:23474373-23474395 GAGAGACACCGCCCCTGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021717709 Original CRISPR AAGCCGGCCCCGGGGAGCGC GGG (reversed) Intergenic