ID: 1021722860

View in Genome Browser
Species Human (GRCh38)
Location 7:23520753-23520775
Sequence GGTTGCAGTGAACCAAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4189
Summary {0: 1, 1: 6, 2: 78, 3: 1213, 4: 2891}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021722860_1021722869 29 Left 1021722860 7:23520753-23520775 CCATCTCTTGGTTCACTGCAACC 0: 1
1: 6
2: 78
3: 1213
4: 2891
Right 1021722869 7:23520805-23520827 GCCTAAGCCTCCCAGGTAGCTGG 0: 12
1: 3211
2: 91952
3: 201542
4: 240893
1021722860_1021722867 22 Left 1021722860 7:23520753-23520775 CCATCTCTTGGTTCACTGCAACC 0: 1
1: 6
2: 78
3: 1213
4: 2891
Right 1021722867 7:23520798-23520820 TTCTCCTGCCTAAGCCTCCCAGG 0: 11
1: 4125
2: 5666
3: 4784
4: 4568
1021722860_1021722862 -10 Left 1021722860 7:23520753-23520775 CCATCTCTTGGTTCACTGCAACC 0: 1
1: 6
2: 78
3: 1213
4: 2891
Right 1021722862 7:23520766-23520788 CACTGCAACCTCCGCCTCCTGGG 0: 19244
1: 108653
2: 218193
3: 184354
4: 113169
1021722860_1021722871 30 Left 1021722860 7:23520753-23520775 CCATCTCTTGGTTCACTGCAACC 0: 1
1: 6
2: 78
3: 1213
4: 2891
Right 1021722871 7:23520806-23520828 CCTAAGCCTCCCAGGTAGCTGGG 0: 15
1: 4156
2: 105528
3: 214478
4: 253134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021722860 Original CRISPR GGTTGCAGTGAACCAAGAGA TGG (reversed) Intronic
Too many off-targets to display for this crispr