ID: 1021725364

View in Genome Browser
Species Human (GRCh38)
Location 7:23543334-23543356
Sequence GGCCAGAGTCCTAGTTGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021725364_1021725371 22 Left 1021725364 7:23543334-23543356 CCTGTACAACTAGGACTCTGGCC No data
Right 1021725371 7:23543379-23543401 AAAAAATTAGGAACAATTGAAGG No data
1021725364_1021725367 -7 Left 1021725364 7:23543334-23543356 CCTGTACAACTAGGACTCTGGCC No data
Right 1021725367 7:23543350-23543372 TCTGGCCCTATCTAGGAGGATGG No data
1021725364_1021725370 10 Left 1021725364 7:23543334-23543356 CCTGTACAACTAGGACTCTGGCC No data
Right 1021725370 7:23543367-23543389 GGATGGAGTTCTAAAAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021725364 Original CRISPR GGCCAGAGTCCTAGTTGTAC AGG (reversed) Intergenic
No off target data available for this crispr