ID: 1021731261

View in Genome Browser
Species Human (GRCh38)
Location 7:23597629-23597651
Sequence GCGAGAGGTGCGGGCCCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 242}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021731261_1021731266 -3 Left 1021731261 7:23597629-23597651 CCAGCCGGGCCCGCACCTCTCGC 0: 1
1: 1
2: 1
3: 23
4: 242
Right 1021731266 7:23597649-23597671 CGCGCGCCCCTCAGCCTAGCCGG 0: 1
1: 0
2: 1
3: 7
4: 84
1021731261_1021731276 29 Left 1021731261 7:23597629-23597651 CCAGCCGGGCCCGCACCTCTCGC 0: 1
1: 1
2: 1
3: 23
4: 242
Right 1021731276 7:23597681-23597703 CCCCGCCGCGCCCCCGTCCCCGG 0: 1
1: 1
2: 18
3: 150
4: 928

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021731261 Original CRISPR GCGAGAGGTGCGGGCCCGGC TGG (reversed) Intronic
900155318 1:1201414-1201436 GCGCGCGGGGCGGGCCCGGGAGG + Intergenic
900189950 1:1349150-1349172 GAGAGCGGTGCGGGCCGGGCGGG - Intronic
900422932 1:2563410-2563432 GGGAGAGGTGGGGCCCCTGCTGG + Exonic
901068925 1:6507751-6507773 GCGGGAGGGGCCGGCCAGGCAGG - Intronic
901806261 1:11740538-11740560 GGCAGAGGTGTGGGCCCAGCTGG + Intronic
901921460 1:12540502-12540524 GCGTGAGGGCCGGGCCAGGCCGG - Intergenic
902032550 1:13433822-13433844 GCGCAAGGTGCGGGACTGGCAGG - Intergenic
902385494 1:16073403-16073425 GCGAGGTGAGGGGGCCCGGCCGG - Exonic
902600908 1:17539759-17539781 CCGCGAGGTCCGGGCCCGCCGGG - Intergenic
903349916 1:22711195-22711217 CCGGGAGGAGCGGGCCCCGCGGG + Intronic
903446056 1:23423861-23423883 GAGGGAGGAGCGGGCTCGGCGGG - Intronic
903653003 1:24932438-24932460 CGCGGAGGTGCGGGCCCGGCCGG + Intronic
905054238 1:35079360-35079382 GGGAGAGGGGCGGGGTCGGCGGG + Intronic
912798598 1:112707166-112707188 GCGGGGAGGGCGGGCCCGGCAGG + Intronic
915143998 1:153783826-153783848 GCGAGAGGGGCGGGGCAGGCTGG + Intergenic
915517534 1:156421872-156421894 GGGGGAGGGGCGGGGCCGGCGGG - Intronic
920333499 1:205228645-205228667 GCCGGAGGTCCGCGCCCGGCAGG - Exonic
922460253 1:225810184-225810206 CCGGGGAGTGCGGGCCCGGCCGG - Intronic
922602961 1:226870843-226870865 GAGAGAGGAGAGTGCCCGGCAGG + Intronic
922705409 1:227787990-227788012 TCGAGAGGAGCGTGCCCCGCAGG + Intergenic
922775704 1:228213399-228213421 GTGAGAGGGGCGGGGCCGGAGGG - Intronic
923107859 1:230868339-230868361 GCGAGAAGTACGGGCCCGAGTGG - Exonic
924436740 1:244049069-244049091 GCCAGCTGTGCGGCCCCGGCCGG + Intronic
1063664540 10:8053580-8053602 GCGAGAGGGGCGGGGCGAGCGGG - Intergenic
1065110453 10:22435875-22435897 GCGAGAGGTGCAGGCCGGGGTGG + Intronic
1068216752 10:53991197-53991219 GCGCGCGGTGCGGGACTGGCAGG + Intronic
1068693804 10:59944483-59944505 GCTAGAGGTGCGGGGTCAGCGGG - Intergenic
1069696221 10:70387406-70387428 GGGAGAGGTGCGGCCCCAGGTGG - Intergenic
1073207463 10:101776370-101776392 GCGGGAGGGGCGGGGGCGGCCGG + Intronic
1075129598 10:119726403-119726425 GGGAGAGGAGGGGGCGCGGCCGG + Intronic
1076922071 10:133459405-133459427 CGGAGAGGTACGGGCCCTGCTGG + Intergenic
1077219161 11:1407828-1407850 GAGTGTGGGGCGGGCCCGGCAGG + Intronic
1077385851 11:2269197-2269219 GGGGGAGGTGCGGGCAGGGCCGG - Intronic
1077491405 11:2862554-2862576 GCGCGAGGAGCGGGCGCGGCCGG - Intergenic
1077491524 11:2862978-2863000 GCGCGAGGGCCGGGCCGGGCAGG - Intergenic
1083366908 11:62146896-62146918 CCGAGAGGTGAGGGACCTGCTGG + Exonic
1083698491 11:64458208-64458230 GGGAGGGGTGCAGGCCAGGCAGG - Intergenic
1084189103 11:67490909-67490931 CCGAGAGCTGCGGGCCCTGGAGG + Exonic
1084979591 11:72822077-72822099 GCGAGAGGCGCGGGCGCAGCAGG + Exonic
1087076244 11:94129210-94129232 GCGAAAGCCGCGCGCCCGGCCGG + Exonic
1089842114 11:121427345-121427367 GCGAGGTGGGCGGGCCGGGCTGG - Intergenic
1091625387 12:2117470-2117492 GGGAGAGCTGAGGGCCCTGCAGG + Intronic
1096122014 12:49094432-49094454 CCCAGAGCTGCGGGCCGGGCCGG - Exonic
1100521526 12:95379970-95379992 GCGCAAGGTGCGGGACTGGCAGG + Intronic
1102068177 12:109996140-109996162 CAGAGGGGAGCGGGCCCGGCCGG + Intronic
1103541993 12:121672618-121672640 GCGCGCGCCGCGGGCCCGGCCGG + Intronic
1104697177 12:130872253-130872275 GTGGGTGGTGCGGGCCCGGCCGG + Intronic
1108686803 13:52826641-52826663 GCGGGAGGTGCGGGAGTGGCAGG + Intergenic
1113461287 13:110484390-110484412 CCCAGAGCTGCGGGCCGGGCGGG - Intronic
1113872176 13:113566028-113566050 GGAAGAGGTGAGGGCCCTGCCGG - Intergenic
1114224180 14:20723422-20723444 GCGCGGGGTTCGGGCCGGGCGGG - Intergenic
1114525901 14:23366582-23366604 CCGAGAGGCGCGGGGACGGCCGG - Intergenic
1115855054 14:37622234-37622256 GCGCGCGGGGCGGGCCGGGCCGG - Intronic
1116657900 14:47674655-47674677 GCGAGTGGAGCGCGCCTGGCTGG - Exonic
1120881321 14:89417108-89417130 GGGAGAGCGGCGGGGCCGGCGGG - Intronic
1121114023 14:91331119-91331141 GGGAGCGGTGCAGGCACGGCAGG + Intronic
1121145466 14:91578359-91578381 GCCAGCGGTGCGGGACTGGCGGG + Intergenic
1122517132 14:102317001-102317023 GCCAGCGGCGCCGGCCCGGCAGG + Intergenic
1124251223 15:28107466-28107488 GGGAGAGGTGGCGGCCTGGCCGG - Intergenic
1124500762 15:30225178-30225200 GCGGCAGGTGCGGGCCCCGGGGG - Intergenic
1124629336 15:31327874-31327896 GCGCGAGGTGGGGGCCGGGCGGG + Intronic
1124742808 15:32313489-32313511 GCGGCAGGTGCGGGCCCCGGGGG + Intergenic
1125429474 15:39580970-39580992 GCGGGAGGTGGGGGCCAGTCTGG - Intergenic
1125833247 15:42730707-42730729 GCGAGGGCTGCAGGCCCGCCGGG - Exonic
1127772581 15:62243422-62243444 GCGAGAGGTCAGGGCACGGCAGG - Intergenic
1127982708 15:64046341-64046363 GCGGGAGCGGCGGGCGCGGCGGG + Intronic
1129115245 15:73361988-73362010 GCCAGAGGGGTGGGCCTGGCTGG - Intronic
1129540258 15:76342572-76342594 GCGGGCGGGGCGGGCCCGGTGGG + Intergenic
1130903270 15:88223094-88223116 GCCAGAGCTGCGGGCTCGGGAGG + Intronic
1131517383 15:93088517-93088539 GCGGGAGGCGGGGGCCCGGGCGG + Intronic
1132522238 16:397174-397196 GCGCGAGGAGCGGGCGCGGAGGG - Intronic
1132566925 16:627803-627825 GCGGGAGGAGGGGGCGCGGCTGG + Exonic
1134290768 16:12901761-12901783 GCGCGGGGTGCAGGTCCGGCCGG - Exonic
1136451043 16:30354513-30354535 GGGAGAGGGGCGGGGCGGGCAGG - Intronic
1138516269 16:57536739-57536761 GCGAGGGGTGCGGGCCGGGGCGG + Intergenic
1140096901 16:71883667-71883689 GCGCGGGGTGCGGGGCCGGGGGG - Intronic
1141185708 16:81785590-81785612 GTGAGAGGTGGGAGCCAGGCTGG + Intronic
1141767423 16:86067827-86067849 GGAAGAGGTGCGGGCCCCGCTGG - Intergenic
1142011942 16:87719928-87719950 GCGGGAGGTGGGGGCCCGTTGGG - Intronic
1142194787 16:88734369-88734391 GCGGGAGGCGCGTGCCAGGCAGG + Exonic
1142209871 16:88803925-88803947 GCGCGGAGTGCGGGCCTGGCGGG - Exonic
1142374141 16:89698092-89698114 GGGTGAGGTGCTGGCCCAGCTGG - Exonic
1142417034 16:89948815-89948837 GTGAGCGGCGCGGGGCCGGCGGG + Intronic
1142494243 17:297955-297977 GAGAGAGGTGGGGGCCAGGGAGG - Intronic
1143564284 17:7712134-7712156 TTGAGAGGTGCGGGCACCGCAGG + Intergenic
1143952620 17:10645719-10645741 GCGAGAGGAGCAGGCCGAGCCGG - Exonic
1144527198 17:16000033-16000055 GTGAGGGGCGCGGGCCGGGCGGG + Intronic
1145787828 17:27605513-27605535 GCGAGAGATGGGGCCCCGCCAGG - Exonic
1145909036 17:28532157-28532179 GGGAGGGGTGGGGGCCAGGCCGG - Intronic
1147420894 17:40321720-40321742 GCAACAGGTGCGGGCCAGCCTGG - Intronic
1147539632 17:41346497-41346519 GCTGGACGTGCGGGCGCGGCTGG - Exonic
1147541582 17:41364828-41364850 GCTGGACGTGCGGGCGCGGCTGG - Exonic
1147543269 17:41379005-41379027 GCTGGACGTGCGTGCCCGGCTGG - Exonic
1147545060 17:41394897-41394919 GCTGGATGTGCGTGCCCGGCTGG - Exonic
1147553670 17:41462879-41462901 GCTGGACGTCCGGGCCCGGCTGG - Exonic
1147555684 17:41477567-41477589 GCTGGACGTCCGGGCCCGGCTGG - Exonic
1148157148 17:45431013-45431035 GGGGGCGGTGCGGGCCGGGCTGG - Intronic
1148496264 17:48055023-48055045 GTGAGAGCTGCGGTCCAGGCGGG - Intronic
1150764681 17:67993742-67993764 GCGCCAGGCGCGGGCCCGGCGGG + Intergenic
1150790603 17:68198182-68198204 GGGGGCGGGGCGGGCCCGGCTGG + Intergenic
1151372545 17:73657572-73657594 GCCAGAGGTGCTGGCAGGGCAGG - Intergenic
1151382417 17:73734978-73735000 GCAAGAGGTGGGGGCCGTGCAGG - Intergenic
1151542415 17:74771346-74771368 GCCAGAGGTGCTGCCCTGGCTGG - Exonic
1151745221 17:76008287-76008309 GCGAGAGCTCCTGGCCCCGCTGG + Exonic
1151817555 17:76478769-76478791 GGCAGAGGTGGGGGCCCTGCAGG + Intronic
1151857967 17:76736695-76736717 GCACGTGGTGCGGGCCCGGACGG - Exonic
1152396564 17:80036611-80036633 GCGCGTGGTCCCGGCCCGGCCGG + Intronic
1152593114 17:81223216-81223238 GCGGGAGGAGCTGGCCGGGCAGG + Intergenic
1152616663 17:81341176-81341198 GCGTGCGGTGCGTGGCCGGCGGG - Intergenic
1152924189 17:83080007-83080029 GCGAGGGGAGGGGGCCGGGCCGG - Intronic
1153666414 18:7370836-7370858 GTGAGCCGTGCTGGCCCGGCAGG + Intergenic
1155152920 18:23136306-23136328 GCGAGAGGCGCCGGCCGGGGCGG - Exonic
1157095091 18:44680168-44680190 GCGGGAAGCGCGGGGCCGGCCGG + Intronic
1157849107 18:51030653-51030675 GCGGGGTGCGCGGGCCCGGCCGG - Intronic
1160725413 19:616088-616110 GCGGCAGGTGCGGGCCCCGGGGG - Exonic
1160738784 19:676539-676561 GCCAGAGGGGCGGGCGGGGCGGG + Intronic
1160786105 19:900813-900835 AGGAGAGGTGCGGGCCTGGCTGG - Exonic
1160824737 19:1074401-1074423 GCAGGAGGTGGGGGCCCCGCGGG + Exonic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1161266384 19:3366604-3366626 GCGGGAGGCGCAGGGCCGGCCGG - Exonic
1161313609 19:3607807-3607829 ACGAGAGGGCCGGGCCAGGCTGG - Intergenic
1161314873 19:3613079-3613101 GCGAGAGCTGCAGGCGCTGCAGG + Exonic
1163420580 19:17211740-17211762 GCTGGAGGAGCGGGCCGGGCGGG + Exonic
1163583875 19:18153754-18153776 GCGGGAGGGGCGGGGCAGGCAGG - Intronic
1163638201 19:18447310-18447332 GCAAGAGATGCAGGCCCTGCTGG - Intronic
1163807064 19:19405866-19405888 GCGAGCGCCGCGGGCCCGGGCGG + Intronic
1165746008 19:38229717-38229739 GCGAGCGGAGCGGGGCGGGCCGG + Intergenic
1165763568 19:38336486-38336508 GCGAGAAACGGGGGCCCGGCCGG + Intronic
1166385103 19:42376386-42376408 GCGGGAGGTGGGAGCCCAGCCGG - Exonic
1166734497 19:45076132-45076154 GCGAGGAGGGCGGCCCCGGCGGG + Exonic
1166785291 19:45363703-45363725 GCGCGGGGTGGGGGCCCGGCAGG - Intronic
1167095890 19:47375025-47375047 GAGAGAGGAGGGGGCTCGGCGGG - Intronic
1167414389 19:49362466-49362488 GAGGGGGGGGCGGGCCCGGCCGG + Intronic
1168144854 19:54415384-54415406 GAGGGAGGCGCGGGCCGGGCGGG - Intronic
1168339314 19:55614473-55614495 GCGGGAGGTGGGGGCCGGGCTGG - Exonic
1168339489 19:55615079-55615101 GCAGGAGGTACGGGCCCGGGGGG - Exonic
925199872 2:1958683-1958705 GTGAGAGGTGGGGGCTCAGCCGG + Intronic
926143703 2:10384192-10384214 GAGGGAGGTGGCGGCCCGGCAGG + Intronic
928518207 2:32063665-32063687 GAGAAAGGGGCGGGGCCGGCGGG + Exonic
929252893 2:39779125-39779147 GCGAGAGGTGCGGGCGCGGCTGG - Exonic
929889973 2:45910794-45910816 GCTAGAGCTGCAGGCCTGGCAGG + Intronic
933049987 2:77590858-77590880 GCGCAAGGTGCGGGACTGGCAGG + Intronic
935592764 2:104856353-104856375 GCGCGTGGTGCGGGTGCGGCGGG - Exonic
938226520 2:129621213-129621235 GTCAGAGGTGCTGGCCAGGCAGG + Intergenic
938252587 2:129827422-129827444 GCGGGAGGTGCGGGAGGGGCAGG + Intergenic
940971956 2:159904754-159904776 GACAGAGGTGCGGGCGGGGCAGG - Intergenic
941111750 2:161424143-161424165 GAGCGAGGTGCTGGCCCAGCGGG + Exonic
946622116 2:221572335-221572357 GCCAAGGGGGCGGGCCCGGCCGG + Intronic
947800934 2:232928208-232928230 GCGGGAGGGGCGCGCGCGGCGGG + Intronic
948385117 2:237576169-237576191 GCGAGAGCTGGGGGCATGGCCGG - Intronic
948612067 2:239176239-239176261 GGGAGGGGTGCGGGCACGGAAGG - Intronic
948612104 2:239176342-239176364 GGGAGGGGTGCGGGCACGGAAGG - Intronic
948874627 2:240820078-240820100 GCGAGGGGCGCGGGCGCGGGAGG + Intronic
949006452 2:241651968-241651990 GCCGGAGGTGAGGGCCGGGCTGG + Intronic
1169044415 20:2524632-2524654 GGGAGAGCTGCGGGCCCCGCCGG + Intronic
1169164111 20:3407678-3407700 GCGCGGCGCGCGGGCCCGGCGGG + Intergenic
1169244590 20:4015572-4015594 TCGCGAGGGGCGGGCCCGCCGGG + Intronic
1172438929 20:34951789-34951811 GCTAGAGGAGCTGGCACGGCAGG - Exonic
1172482273 20:35277993-35278015 GCGAGAGGTGAGGGCAGAGCCGG - Intergenic
1175309746 20:58003515-58003537 GCATGAGGAGCGGGCCTGGCAGG + Intergenic
1175847261 20:62065443-62065465 GCGGGCGGCGCGGGCCCTGCGGG + Exonic
1175891845 20:62319186-62319208 GCAGGAGGTGAGGGCCGGGCAGG - Intronic
1175911468 20:62407209-62407231 GCGGGTGGCGGGGGCCCGGCGGG + Exonic
1176029818 20:63006557-63006579 GCGCGAGGTGCAGGCGCCGCGGG + Exonic
1176107426 20:63395938-63395960 GGAGGAGGTGCGGGCCTGGCCGG + Intergenic
1176202015 20:63865388-63865410 GCGAAGGGGCCGGGCCCGGCAGG - Intronic
1176675458 21:9773016-9773038 GAGAGAGGTTCAGGCCCGGTGGG - Intergenic
1178916667 21:36708899-36708921 GCGGGAGCTGTGGGCCTGGCAGG + Intronic
1179479906 21:41670421-41670443 GCGTGCGGGGCGTGCCCGGCTGG + Intergenic
1180235727 21:46458541-46458563 CCGAGAGGGGCGGGGCTGGCCGG + Intergenic
1180614938 22:17120793-17120815 GCGACAGGCGCGGGGCCGGCGGG + Exonic
1181083976 22:20430836-20430858 GCTTGACGTGCGAGCCCGGCTGG - Exonic
1181094427 22:20495844-20495866 GCGAGAGGAGCCGGCGGGGCGGG + Exonic
1181658505 22:24321598-24321620 GCGAGACATGCGTGCCCAGCTGG + Exonic
1181681289 22:24497519-24497541 GGGAGAGGTGGGGGCCCTGAAGG + Intronic
1183490400 22:38112616-38112638 GGGCGGGGTGCGGGCCGGGCGGG - Intronic
1183548119 22:38466153-38466175 GCGAGAGGTGGGTGAGCGGCCGG - Intergenic
1184986827 22:48141511-48141533 GGCAGAGGCACGGGCCCGGCTGG + Intergenic
1185413501 22:50697773-50697795 GCGCGCGGTGCTGGCCGGGCCGG + Intergenic
949928200 3:9058428-9058450 CCGGAAGGTGCGGGCCAGGCTGG + Exonic
950569914 3:13793434-13793456 GCGAGCCTTGCGGGCCTGGCTGG - Intergenic
952367236 3:32685514-32685536 GCGGGACGTGCGGGGCCGGGCGG + Intronic
953418011 3:42734086-42734108 GGGAGGGGTGGGGGCCTGGCAGG - Intronic
953910895 3:46892633-46892655 GCGAGAGGGGCGGGCAGGCCGGG - Intronic
954785934 3:53092422-53092444 GCGATAGGTGCAGGCCAGCCAGG + Exonic
954886789 3:53881963-53881985 GCAAGAGGTGCGGCTCTGGCTGG - Exonic
956438890 3:69260638-69260660 GCGCGTGGTGCGGGACTGGCGGG + Intronic
962208877 3:133459587-133459609 GGCAGAGGAGCTGGCCCGGCTGG - Intronic
964983086 3:162710482-162710504 GCGCAAGGTGCGGGACTGGCAGG - Intergenic
966390927 3:179451556-179451578 ACGAGGCGCGCGGGCCCGGCGGG + Exonic
966945364 3:184773820-184773842 GCCAGAGGTGCGGCTCCGACAGG + Intergenic
968066514 3:195762320-195762342 GGGGGTGGTGCGGGCCCGGCAGG - Intronic
968478919 4:825533-825555 CCGAGGGGTGCGGGTGCGGCGGG - Intronic
968505102 4:967859-967881 GGGTGAGGTGCGGGCCGGCCGGG - Exonic
968625205 4:1623894-1623916 GGGAGAAGTGGGTGCCCGGCTGG + Intronic
969379420 4:6783692-6783714 GCGCGGGGGGCGGGCCTGGCGGG + Intronic
969582565 4:8073581-8073603 GAGAGAGGAGAGGGCCAGGCAGG + Intronic
971244140 4:24913110-24913132 GGGCGCGGGGCGGGCCCGGCGGG - Intronic
973754747 4:54064136-54064158 GCGGGAGGTGCGGGCTGGGGTGG - Intronic
974385632 4:61200430-61200452 GCGAGCGGTGCCGGGCCAGCAGG - Intergenic
974433835 4:61832217-61832239 GAGAGATGTGTGGGCCTGGCAGG + Intronic
976812437 4:89111407-89111429 GGGAGGGGCGGGGGCCCGGCAGG - Intergenic
979523828 4:121697076-121697098 GGGGCAGGGGCGGGCCCGGCTGG - Exonic
982139466 4:152304204-152304226 GGGAGGGGTCCGGGCCTGGCAGG + Intergenic
985400091 4:189585681-189585703 GAGAGAGGTTCAGGCCCGGTGGG + Intergenic
985995630 5:3595673-3595695 GCGAGAGTAGCTGGCCGGGCCGG + Intergenic
985995645 5:3595715-3595737 GCGGGAGGGGCGGGAGCGGCCGG + Intergenic
988177340 5:27743847-27743869 GCGCAAGGTGCGGGACTGGCAGG + Intergenic
988547663 5:32173794-32173816 CCGCGAGGTGCGGGCGCGGCGGG - Exonic
992939512 5:81750032-81750054 GCGGGAGGGGCGGGCCCGGCGGG - Intronic
993045576 5:82862437-82862459 GGGAAAGGTGCTGGCCCAGCTGG + Intergenic
995047878 5:107670984-107671006 GAGGGAGGTGCGCGCCGGGCCGG + Intergenic
997201327 5:132011680-132011702 GCGGGAGCTGCGGGGCCGGAGGG - Intronic
997582799 5:135028050-135028072 GCGGGCAGTGCGGGCCTGGCGGG - Exonic
998096261 5:139397018-139397040 GTGAGGGGTCTGGGCCCGGCTGG - Intronic
998415629 5:141944367-141944389 TAGAGAGGTGCGGGCCTGGATGG + Exonic
1002524179 5:179806452-179806474 GCGCCAGGTGCGGGCCGGGCGGG + Intronic
1004924498 6:20403770-20403792 GGGGGAGGTGGGGGGCCGGCTGG - Intronic
1005851724 6:29827958-29827980 GAGGGAGGGGCCGGCCCGGCGGG + Intronic
1005931691 6:30489636-30489658 TAGAGAGGGGCCGGCCCGGCGGG + Intronic
1005956997 6:30671208-30671230 GCGAGAGGCCCGGGCCCTGCTGG - Exonic
1007473295 6:42104442-42104464 AGGTGAGCTGCGGGCCCGGCTGG - Exonic
1007622902 6:43225795-43225817 GGGAGAGGTGGAGGCCCTGCTGG - Exonic
1008511953 6:52284465-52284487 GCTGGAGGCTCGGGCCCGGCAGG + Intronic
1008545061 6:52576935-52576957 GCGCAGGGTGCGGGCCCCGCCGG - Intergenic
1010703322 6:79077824-79077846 GCGCGCGGCGCGGGCCGGGCCGG - Intronic
1013853308 6:114541823-114541845 GTGAAAGGTGCGGGACTGGCAGG - Intergenic
1015315014 6:131807934-131807956 CCGCGAGGGGCGGGCGCGGCGGG + Intergenic
1018956440 6:168413330-168413352 GTGAGCGGGGCGGGCCCTGCGGG + Intergenic
1019453045 7:1109656-1109678 GTGAGTGGGGAGGGCCCGGCGGG - Intronic
1019453070 7:1109710-1109732 GTGAGTGGGGAGGGCCCGGCGGG - Intronic
1019641550 7:2106242-2106264 GTGAAAGGTGCGAGCACGGCAGG + Intronic
1020278232 7:6637291-6637313 GCGGGCGGGGCGGGGCCGGCCGG + Intergenic
1021731261 7:23597629-23597651 GCGAGAGGTGCGGGCCCGGCTGG - Intronic
1022106203 7:27199650-27199672 TCGGGAGGTCCCGGCCCGGCGGG - Exonic
1024800336 7:53070099-53070121 CCGAGAGATGTGGGCCCTGCAGG + Intergenic
1025697894 7:63789641-63789663 GAGAGAGGGGCGGGGCCGGGAGG - Intergenic
1028160081 7:87475609-87475631 GAGAGAGGTCCGGGCGCGTCTGG - Intronic
1029746479 7:102517943-102517965 ATGAGAGCTGCGGCCCCGGCCGG - Intergenic
1029764416 7:102616922-102616944 ATGAGAGCTGCGGCCCCGGCCGG - Intronic
1030216010 7:107044637-107044659 GGGAGAGGCGCGGCCGCGGCTGG + Exonic
1033477187 7:141702177-141702199 GCGCGAGGGGCGGGGCGGGCGGG + Intergenic
1034618079 7:152436041-152436063 GCGGGCGGTGCGGGGCGGGCGGG + Intergenic
1034908395 7:154971445-154971467 GCGAGAGGTGCAGGCCTGGATGG + Intronic
1035018529 7:155787298-155787320 GCAAGGGGTCCGGGCCCGCCTGG + Intergenic
1036789520 8:11708724-11708746 GCGGCGGGTGCGGGCCTGGCGGG + Exonic
1037788994 8:21919989-21920011 GCGCGAGGTGTGGGACCGGGTGG - Intronic
1038035482 8:23682919-23682941 GAAAGCGGTGCGGGCCGGGCGGG - Exonic
1038442223 8:27579346-27579368 CTGAGAGGTGAGGGCCAGGCAGG - Intergenic
1038644945 8:29353070-29353092 GCGCCAGGCGCGGGTCCGGCGGG - Intergenic
1041059436 8:54022031-54022053 GCGAGCGGCGCGGGCCGGGAGGG - Intronic
1049608499 8:143541157-143541179 GGGAGTGGTGCCGGCCCTGCTGG - Intronic
1051418868 9:16870987-16871009 GCGGGAGGCGGGGGACCGGCGGG + Intergenic
1056163551 9:83921275-83921297 GCGGGAGCGGCGGGCGCGGCGGG + Intronic
1057139732 9:92719138-92719160 CCGCGAGCTGCTGGCCCGGCTGG - Exonic
1060814360 9:126626919-126626941 GCGGACGCTGCGGGCCCGGCCGG - Intronic
1061976027 9:134068299-134068321 GAGAGCCGTGCGGGCCCGGGCGG - Intronic
1062277445 9:135737547-135737569 GAGAGAGGTGCAGGCCAGGCCGG + Intronic
1062341190 9:136094683-136094705 GGGCGAGGCGCGGGCCCGGCTGG + Intronic
1062460202 9:136659784-136659806 GTCAGAGGTGGAGGCCCGGCAGG - Intronic
1062561972 9:137145701-137145723 GCGGGAGGCGGGGGCACGGCGGG - Intronic
1062570931 9:137185014-137185036 TCGGGAGATGCGGGCCTGGCGGG + Exonic
1187669850 X:21657280-21657302 GCGCGGGGCGCGGGCCCCGCGGG - Exonic
1190024664 X:46912539-46912561 GCGCGGGGGGCGGCCCCGGCGGG + Exonic
1195210908 X:102651771-102651793 GTGACTGGTGCGGGCCAGGCCGG + Intronic
1195625163 X:106999790-106999812 GCGCGCGGGGAGGGCCCGGCGGG - Intronic
1198398939 X:136251289-136251311 GAGAGAGCTGCGGGCACGGATGG - Exonic
1198480219 X:137033916-137033938 GCGGGCGCTGCGGGCGCGGCAGG + Intergenic