ID: 1021733190 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:23617262-23617284 |
| Sequence | CACTTGAATCCAGGAGACGG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 154563 | |||
| Summary | {0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1021733185_1021733190 | 9 | Left | 1021733185 | 7:23617230-23617252 | CCTAGCTACTCGGGAGGCTGAGG | 0: 99957 1: 284367 2: 226920 3: 125442 4: 164576 |
||
| Right | 1021733190 | 7:23617262-23617284 | CACTTGAATCCAGGAGACGGAGG | 0: 22 1: 910 2: 11219 3: 45370 4: 97042 |
||||
| 1021733183_1021733190 | 17 | Left | 1021733183 | 7:23617222-23617244 | CCTGTAATCCTAGCTACTCGGGA | 0: 1741 1: 53151 2: 219857 3: 260311 4: 206836 |
||
| Right | 1021733190 | 7:23617262-23617284 | CACTTGAATCCAGGAGACGGAGG | 0: 22 1: 910 2: 11219 3: 45370 4: 97042 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1021733190 | Original CRISPR | CACTTGAATCCAGGAGACGG AGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||