ID: 1021733190

View in Genome Browser
Species Human (GRCh38)
Location 7:23617262-23617284
Sequence CACTTGAATCCAGGAGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154563
Summary {0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021733185_1021733190 9 Left 1021733185 7:23617230-23617252 CCTAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 1021733190 7:23617262-23617284 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
1021733183_1021733190 17 Left 1021733183 7:23617222-23617244 CCTGTAATCCTAGCTACTCGGGA 0: 1741
1: 53151
2: 219857
3: 260311
4: 206836
Right 1021733190 7:23617262-23617284 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021733190 Original CRISPR CACTTGAATCCAGGAGACGG AGG Intronic
Too many off-targets to display for this crispr