ID: 1021736484

View in Genome Browser
Species Human (GRCh38)
Location 7:23643043-23643065
Sequence CAATGGTACTAGTGGGAATT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021736484 Original CRISPR CAATGGTACTAGTGGGAATT TGG Exonic
901173671 1:7282991-7283013 TATTGATAATAGTGGGAATTTGG + Intronic
902717100 1:18280341-18280363 CAGTAGAACTAGTGGCAATTGGG - Intronic
918909518 1:190547726-190547748 TAATGGGCCCAGTGGGAATTAGG + Intergenic
921454221 1:215348228-215348250 CAATGATACTAGAGGGAGCTGGG - Intergenic
922138356 1:222854988-222855010 CAGTACTACTAGTGGGAATAGGG + Intergenic
1063904070 10:10765177-10765199 AAATGGGACCAGTGGGAAATGGG - Intergenic
1068794175 10:61059621-61059643 AATTGATACTACTGGGAATTAGG + Intergenic
1069421674 10:68252079-68252101 CAATTGTAATAATGGGAAATTGG + Intergenic
1070847696 10:79537415-79537437 CAATGGGAGCAGTGGGCATTTGG - Intergenic
1070926086 10:80222714-80222736 CAATGGGAGCAGTGGGCATTTGG + Intergenic
1072437520 10:95427701-95427723 GAATGTTTCTAATGGGAATTTGG - Intronic
1075327544 10:121546562-121546584 CAATAGAACTATTTGGAATTCGG - Intronic
1077871215 11:6263107-6263129 CAATGTTACCAATAGGAATTTGG + Intronic
1101239357 12:102823239-102823261 CAATCTTACTAGTGGGCACTTGG + Intergenic
1104566586 12:129890378-129890400 CAATGGTACTATTGGGATTGGGG + Intronic
1108332975 13:49409010-49409032 CAAAGGTATTAGTGGGAAAGGGG + Intronic
1109835562 13:67852073-67852095 CTATAGTAGTAGTGGGAAGTGGG + Intergenic
1110032058 13:70628379-70628401 CAATGCTCCAACTGGGAATTGGG + Intergenic
1111069046 13:83138240-83138262 CATTGGTGTTAGTGGGCATTTGG + Intergenic
1111169352 13:84504622-84504644 AAATGGTTCCAGTGGAAATTAGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1113179192 13:107606162-107606184 CAATGGTACTAGTGAGCACATGG + Intronic
1114810795 14:25896741-25896763 CAAAAGTACTATTGGGAAGTTGG - Intergenic
1119149514 14:72345464-72345486 CAATGGCACAAGTGGAATTTGGG - Intronic
1119955671 14:78796283-78796305 CCATTGTATAAGTGGGAATTTGG - Intronic
1119996666 14:79261148-79261170 TAATGGGAGCAGTGGGAATTGGG + Intronic
1124363587 15:29055916-29055938 CCATGGTACTAGTGGGTGTTGGG + Intronic
1127085357 15:55419536-55419558 CAATGTTAAAAGTGGGAAATTGG - Intronic
1128483238 15:68058115-68058137 CAATGGTTGTAGCGGGAACTGGG + Intronic
1138240904 16:55426276-55426298 CAATGCTACTAGTGAGTGTTAGG + Intronic
1155847246 18:30723578-30723600 CACAGGTACTAGTCGGAATTGGG - Intergenic
1156565114 18:38179489-38179511 GCATGATACTATTGGGAATTTGG + Intergenic
1159979655 18:74762549-74762571 CAATGGAAAAAATGGGAATTTGG - Intronic
1163373218 19:16914203-16914225 CCATGCTACTAGGGGGAAATTGG - Intronic
925670362 2:6304168-6304190 CAATGGGACTAGAAGAAATTTGG - Intergenic
926049858 2:9737720-9737742 CAGGGGTACTAGAGGGAATGGGG - Intergenic
936638058 2:114281861-114281883 ACATGGTACTAGTGTGTATTAGG - Intergenic
946658643 2:221976324-221976346 CAATGGAAGTAGTGGGAAGTGGG - Intergenic
947105056 2:226660664-226660686 CAATGCTACTATTGGCATTTGGG - Intergenic
1178399141 21:32268691-32268713 TTATGGTACTTGTTGGAATTGGG - Exonic
1182348463 22:29683923-29683945 CATGGGTACTACTGGGGATTAGG - Intronic
1182402033 22:30085914-30085936 TAATAGTGGTAGTGGGAATTAGG + Intronic
949339694 3:3015962-3015984 CACTGATACTAATGGGATTTTGG + Intronic
950163641 3:10777992-10778014 GAATGGTGCTATTGGGAATGGGG - Intergenic
950168950 3:10822974-10822996 AAATGCTACTGGTGGGACTTAGG + Intronic
953606987 3:44418756-44418778 CAGTGGCAGGAGTGGGAATTGGG - Intergenic
953707336 3:45241141-45241163 CTATAGTATTGGTGGGAATTTGG + Intergenic
956205452 3:66750334-66750356 TTATGGAACTAGTGGGAAGTTGG - Intergenic
957002619 3:74903785-74903807 CATTGGTAGGAGTGGAAATTTGG + Intergenic
958955527 3:100461867-100461889 CAATGAGAATAGAGGGAATTCGG - Intergenic
965546492 3:169921674-169921696 CGATGGTCATAGTGAGAATTTGG + Intronic
966399491 3:179534223-179534245 CAAGGGTAGAAGTGGGAGTTAGG + Intergenic
967359656 3:188615002-188615024 CAATGGTTCAAGTGAGAAATGGG - Intronic
968239398 3:197062946-197062968 CAATGGCAGTAGTGGGAGTGAGG - Intronic
974300031 4:60051532-60051554 CAAAATTACCAGTGGGAATTTGG - Intergenic
976080153 4:81346246-81346268 CAATGCTGTTAGTGGCAATTTGG - Intergenic
978814215 4:112884849-112884871 CAAAGGTGCTAAAGGGAATTTGG - Intronic
979311743 4:119211925-119211947 AAAAGGTACTGCTGGGAATTGGG - Intronic
979949086 4:126869168-126869190 AAATTGTACTAGTTGGCATTTGG - Intergenic
980456151 4:133046308-133046330 ACAGGGTACTAGTGGGAATAGGG - Intergenic
986497747 5:8363420-8363442 CAATCTTACTATTTGGAATTTGG - Intergenic
987538822 5:19226204-19226226 CAATGGTAGTATTTGGAAATTGG + Intergenic
990510780 5:56487547-56487569 CAATAGGACTAGTGGGAAGTTGG + Intergenic
990623366 5:57584372-57584394 AAATGGTAGCAGTGGGAATGAGG - Intergenic
991971408 5:72145227-72145249 GAAAGATACTATTGGGAATTTGG + Intronic
992176129 5:74150491-74150513 CATGGGTACTAATGGGAGTTTGG - Intergenic
994588186 5:101738315-101738337 CCATGGGAATAGTGGGAATCCGG + Intergenic
995205631 5:109476599-109476621 TAATGGTTCTAGTGGAACTTGGG + Intergenic
1002336264 5:178480480-178480502 CAATGGTGTTAGTGGGATCTTGG - Intronic
1006723152 6:36173555-36173577 AAATGGTACAAGTGGGGATGAGG - Intergenic
1007818960 6:44545850-44545872 CAGTGGTAATAGAGGGAATCTGG - Intergenic
1008299189 6:49813576-49813598 AACTGGCACTTGTGGGAATTAGG + Intergenic
1010040564 6:71378171-71378193 AGATGGTGCTAATGGGAATTTGG + Intergenic
1010800616 6:80170456-80170478 CTTTGGTATCAGTGGGAATTGGG + Intronic
1011266509 6:85525295-85525317 CAATAGTACTAGTAGAAATAAGG + Intronic
1012360565 6:98373085-98373107 CCATGGGACTAGTGGCTATTTGG - Intergenic
1016829354 6:148418054-148418076 CAGTGGTCCTAGTGGGCACTTGG + Intronic
1018337356 6:162807628-162807650 CAATGTTACTATTGTGATTTTGG - Intronic
1021736484 7:23643043-23643065 CAATGGTACTAGTGGGAATTTGG + Exonic
1021798490 7:24281835-24281857 CAAAGGTACATGTGGAAATTTGG + Intergenic
1021802707 7:24323794-24323816 CCATGGTAATGGTGGGGATTGGG - Intergenic
1030221229 7:107101321-107101343 CAATGGGACTTGTGTGAGTTTGG + Intronic
1040474628 8:47765015-47765037 CAAAGGCAGTAGTGGGAAGTGGG - Intergenic
1041090633 8:54297953-54297975 TGATGGTGCTAGTGGGTATTTGG + Intergenic
1042583864 8:70313489-70313511 CACTGGTAATAGTGGTAACTCGG + Intronic
1044412680 8:91901922-91901944 CCATGGAGCCAGTGGGAATTGGG - Intergenic
1048366347 8:133742184-133742206 CACTGCTATTAGTGGGACTTTGG + Intergenic
1048375122 8:133816565-133816587 CAGTGGAACCAGAGGGAATTTGG + Intergenic
1049482532 8:142833657-142833679 CATTGGCACTAGTAGGATTTTGG - Intergenic
1049483181 8:142837364-142837386 CATTGGCACTAGTAGGATTTTGG + Intronic
1050733502 9:8736163-8736185 TGGTGGTACTGGTGGGAATTAGG + Intronic
1050930564 9:11318782-11318804 AAATGCTAGTAGTGGGAATGAGG + Intergenic
1051250371 9:15152861-15152883 CAATGCTGCTGGTGGGACTTTGG - Intergenic
1051327099 9:15983949-15983971 CAATGGTTCTGGTGGGAAGATGG - Intronic
1056898011 9:90569160-90569182 AAATTGTACGAGTAGGAATTAGG + Intergenic
1062167973 9:135117854-135117876 GAAAGGATCTAGTGGGAATTTGG - Intronic
1188336670 X:28943813-28943835 CAATGACACTAAAGGGAATTGGG - Intronic
1193014304 X:76715077-76715099 CAAGGGTTCTTGTGGGAAATAGG + Intergenic
1199728271 X:150606295-150606317 CAAGGGTACTGGCAGGAATTAGG - Intronic
1200393386 X:155967302-155967324 CAATGGCAACAGTGGGATTTTGG - Intergenic