ID: 1021737893

View in Genome Browser
Species Human (GRCh38)
Location 7:23657133-23657155
Sequence CCCTGCCACGAGCAGGGCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021737893_1021737905 18 Left 1021737893 7:23657133-23657155 CCTACGCCCTGCTCGTGGCAGGG No data
Right 1021737905 7:23657174-23657196 TTGGGAGATATGTTCTCAATGGG No data
1021737893_1021737904 17 Left 1021737893 7:23657133-23657155 CCTACGCCCTGCTCGTGGCAGGG No data
Right 1021737904 7:23657173-23657195 GTTGGGAGATATGTTCTCAATGG No data
1021737893_1021737899 -1 Left 1021737893 7:23657133-23657155 CCTACGCCCTGCTCGTGGCAGGG No data
Right 1021737899 7:23657155-23657177 GGTATGAAGGCACCCCAAGTTGG No data
1021737893_1021737900 0 Left 1021737893 7:23657133-23657155 CCTACGCCCTGCTCGTGGCAGGG No data
Right 1021737900 7:23657156-23657178 GTATGAAGGCACCCCAAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021737893 Original CRISPR CCCTGCCACGAGCAGGGCGT AGG (reversed) Intergenic
No off target data available for this crispr