ID: 1021737899

View in Genome Browser
Species Human (GRCh38)
Location 7:23657155-23657177
Sequence GGTATGAAGGCACCCCAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021737897_1021737899 -8 Left 1021737897 7:23657140-23657162 CCTGCTCGTGGCAGGGGTATGAA No data
Right 1021737899 7:23657155-23657177 GGTATGAAGGCACCCCAAGTTGG No data
1021737888_1021737899 19 Left 1021737888 7:23657113-23657135 CCTTCAGAGAAGCCACTGACCCT No data
Right 1021737899 7:23657155-23657177 GGTATGAAGGCACCCCAAGTTGG No data
1021737891_1021737899 0 Left 1021737891 7:23657132-23657154 CCCTACGCCCTGCTCGTGGCAGG No data
Right 1021737899 7:23657155-23657177 GGTATGAAGGCACCCCAAGTTGG No data
1021737893_1021737899 -1 Left 1021737893 7:23657133-23657155 CCTACGCCCTGCTCGTGGCAGGG No data
Right 1021737899 7:23657155-23657177 GGTATGAAGGCACCCCAAGTTGG No data
1021737889_1021737899 7 Left 1021737889 7:23657125-23657147 CCACTGACCCTACGCCCTGCTCG No data
Right 1021737899 7:23657155-23657177 GGTATGAAGGCACCCCAAGTTGG No data
1021737887_1021737899 20 Left 1021737887 7:23657112-23657134 CCCTTCAGAGAAGCCACTGACCC No data
Right 1021737899 7:23657155-23657177 GGTATGAAGGCACCCCAAGTTGG No data
1021737896_1021737899 -7 Left 1021737896 7:23657139-23657161 CCCTGCTCGTGGCAGGGGTATGA No data
Right 1021737899 7:23657155-23657177 GGTATGAAGGCACCCCAAGTTGG No data
1021737886_1021737899 26 Left 1021737886 7:23657106-23657128 CCTCTGCCCTTCAGAGAAGCCAC No data
Right 1021737899 7:23657155-23657177 GGTATGAAGGCACCCCAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021737899 Original CRISPR GGTATGAAGGCACCCCAAGT TGG Intergenic
No off target data available for this crispr