ID: 1021740262

View in Genome Browser
Species Human (GRCh38)
Location 7:23679913-23679935
Sequence TAATTTACAAGAAGACTCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 2, 1: 0, 2: 0, 3: 2, 4: 77}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021740261_1021740262 -10 Left 1021740261 7:23679900-23679922 CCTTGTCACTTGTTAATTTACAA No data
Right 1021740262 7:23679913-23679935 TAATTTACAAGAAGACTCGCCGG 0: 2
1: 0
2: 0
3: 2
4: 77
1021740259_1021740262 16 Left 1021740259 7:23679874-23679896 CCTGTTATATGCAAGGCACTGCA No data
Right 1021740262 7:23679913-23679935 TAATTTACAAGAAGACTCGCCGG 0: 2
1: 0
2: 0
3: 2
4: 77
1021740260_1021740262 -9 Left 1021740260 7:23679899-23679921 CCCTTGTCACTTGTTAATTTACA No data
Right 1021740262 7:23679913-23679935 TAATTTACAAGAAGACTCGCCGG 0: 2
1: 0
2: 0
3: 2
4: 77
1021740257_1021740262 30 Left 1021740257 7:23679860-23679882 CCATTTTCTATGCGCCTGTTATA No data
Right 1021740262 7:23679913-23679935 TAATTTACAAGAAGACTCGCCGG 0: 2
1: 0
2: 0
3: 2
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021740262 Original CRISPR TAATTTACAAGAAGACTCGC CGG Intergenic
904994377 1:34619635-34619657 TAGGTTACAAAAAGACTCTCTGG - Intergenic
908888403 1:68816224-68816246 TAATTCATTAGAAGACTCACAGG - Intergenic
912194730 1:107384377-107384399 AAATGTACAAGAAGACTTTCTGG + Intronic
913005788 1:114630016-114630038 TAATTAAAAAGAAAACTGGCTGG + Intronic
916958311 1:169863205-169863227 GAATTTAGAAGAATACTGGCCGG - Intronic
921335428 1:214081022-214081044 AAATTTACAAGAATAATTGCTGG + Intergenic
924131062 1:240908740-240908762 TAATTCACAAGAAAACTAGGAGG + Intronic
924212236 1:241782408-241782430 TAAATAAATAGAAGACTCGCAGG + Intronic
1064355251 10:14611137-14611159 TAATACACAGGAAGACTCTCAGG - Intronic
1066581649 10:36888289-36888311 TTATTTACAAGAATCCTCACAGG + Intergenic
1069836679 10:71313653-71313675 TGAGTTCCAAGCAGACTCGCTGG + Intergenic
1072432065 10:95381485-95381507 TTTTTTAAAAGCAGACTCGCGGG + Intronic
1072844458 10:98814334-98814356 TAATCTACAAAAATACTGGCAGG - Intronic
1073335851 10:102708237-102708259 ATATTTACAAGAAGTCTCCCTGG + Intronic
1073369979 10:102979223-102979245 TATTTTAAAAGATCACTCGCTGG - Intronic
1076745825 10:132513028-132513050 GAATTTACCAGAAGGCTGGCTGG - Intergenic
1082964866 11:58956708-58956730 GAACTTACAACCAGACTCGCAGG - Exonic
1090000969 11:122957679-122957701 TAAGTTACAAGAAAACGGGCTGG - Intronic
1090096800 11:123750258-123750280 TGAATTACAAGAAGACTTTCAGG - Intergenic
1091471799 12:734767-734789 TAATTTTCAAGAAGCTTGGCCGG - Intergenic
1094376755 12:29798416-29798438 TAAATTAAAAGAAGACACGTAGG + Intergenic
1094413180 12:30189892-30189914 TAATTTACAAGAAGCTTGGAGGG + Intergenic
1098407445 12:70141120-70141142 TAAATTACAAGAAGTCACCCAGG - Intergenic
1105736514 13:23277487-23277509 TTATTTAAATGAAGACTCACTGG + Intronic
1107522785 13:41200137-41200159 TAAATTACAAGAAAACTTGAGGG - Intergenic
1112329747 13:98468240-98468262 GAATTTAGAACAAGACTTGCTGG - Intronic
1116533654 14:46004871-46004893 TAATTAACAAGAAAACACGGAGG - Intergenic
1126338713 15:47616004-47616026 TAATTTACAGGAAGACTTTAGGG - Intronic
1127712097 15:61609496-61609518 TAAATTACATGAGCACTCGCAGG + Intergenic
1136450765 16:30353273-30353295 TATTTTAGAAGCAGAGTCGCGGG - Exonic
1139648534 16:68349466-68349488 TTATTTAAAAAAAGACTGGCAGG - Intronic
1140874794 16:79140826-79140848 TGAGTGACAAGAAGACTCTCCGG - Intronic
1146025931 17:29320858-29320880 AAACTTACAAGAAAACTCTCAGG - Intergenic
1149406698 17:56359274-56359296 TAAGTTACTAGAAGACTTGAAGG - Intronic
1156565492 18:38184284-38184306 TAATTTAAAAAAAAAATCGCCGG - Intergenic
1157772165 18:50358738-50358760 TAAATCAGAAGAAAACTCGCAGG + Intergenic
1159450021 18:68589251-68589273 TAACTTACAAGAAGAGAAGCAGG + Intergenic
1163855114 19:19695515-19695537 TAATTTAAAAAAAGAATAGCCGG - Intergenic
926328125 2:11802993-11803015 TCAGCTACAAGAAGACTCTCCGG + Exonic
930113665 2:47700580-47700602 TATTTAACTAGAAGACTAGCTGG - Intronic
930457807 2:51628740-51628762 TTATTTACAAGAAGACACTGGGG - Intergenic
935590641 2:104843627-104843649 GAATGTACCAGAAGTCTCGCTGG + Intergenic
947287332 2:228531252-228531274 TAATTTACAACAACACTATCCGG + Intergenic
1170077662 20:12437383-12437405 TAATCTCCAGGAAGACTCCCTGG - Intergenic
1174067653 20:47877285-47877307 TCATTCACAAGAAGACACGATGG - Intergenic
1177368082 21:20164646-20164668 TACTTTATAAGAAGACTGACAGG + Intergenic
1177781107 21:25623179-25623201 TAATTTACAAACAGGCTGGCTGG + Intergenic
951377218 3:21933704-21933726 TAATTTATATGAAGACTCAACGG - Intronic
957119327 3:76069374-76069396 CAATTTAAAAGCAGACTTGCAGG - Intronic
965129527 3:164678664-164678686 TAATTTACATGAGGACATGCAGG + Intergenic
968331559 3:197874812-197874834 TGATTTACAAGAAGAAGTGCTGG - Intronic
968864192 4:3197374-3197396 TAATTAACAAGAAGAGGCCCTGG - Intronic
977868324 4:102058164-102058186 TTATTTACTAGGAGACTGGCTGG - Intronic
979537366 4:121838667-121838689 TAATTTAGAAGATGACTGTCAGG + Intronic
980422931 4:132586868-132586890 AAATTTGCAAGAAGACTCTAAGG - Intergenic
983758025 4:171365965-171365987 TAATTTTCAAGGAGACTGACAGG + Intergenic
985195646 4:187426239-187426261 TGATTTATAAGAAGTCTCTCTGG + Intergenic
988350899 5:30106282-30106304 TAAATTTCAAGAAGAATCCCAGG + Intergenic
1000170267 5:158695487-158695509 TAGTTGACCAGAAGGCTCGCTGG + Intergenic
1000715998 5:164645057-164645079 TAATTTACAATAAAAATCGAAGG + Intergenic
1005456192 6:26021827-26021849 TGATCTACGAGGAGACTCGCGGG + Exonic
1005475622 6:26204793-26204815 TCATCTACGAGGAGACTCGCGGG + Exonic
1005643999 6:27824273-27824295 TCATCTACGAGGAGACTCGCGGG + Exonic
1005645198 6:27831357-27831379 TCATCTACGAGGAGACTCGCGGG - Exonic
1016284380 6:142456352-142456374 TAACTTACAAGGAGATTCTCAGG - Intergenic
1016611261 6:145992565-145992587 TATTTTAAAAGAAGTCTGGCTGG + Intergenic
1021740262 7:23679913-23679935 TAATTTACAAGAAGACTCGCCGG + Intergenic
1021814308 7:24432763-24432785 TAATTTACAAGAAGACTCGCGGG + Intergenic
1027528245 7:79298474-79298496 TAAATTATAAGAACACTGGCAGG - Intronic
1030568040 7:111185611-111185633 TAATCTACAAGAATACTTGTAGG - Intronic
1036176501 8:6543229-6543251 TAATTTACACGAAGACTCAGCGG + Intronic
1038374274 8:27022868-27022890 TAATTCTCCAGCAGACTCGCTGG + Intergenic
1046026465 8:108730134-108730156 TAAGTTACAGAAAGACTAGCAGG - Intronic
1046319552 8:112554332-112554354 TAATTTACAATAACACACTCGGG + Intronic
1047126726 8:121970577-121970599 TAATTTTCAGGAAGAGTAGCTGG - Intergenic
1187941807 X:24389785-24389807 TAATATACAAGAATGCTGGCCGG - Intergenic
1188580809 X:31710636-31710658 TATTTTACAACAAGACTGGCAGG - Intronic
1188838510 X:34987493-34987515 ATATTTACAAGGAGACTCACAGG + Intergenic
1198410979 X:136367670-136367692 TAATTTACAAGTAGAATAGAAGG - Intronic
1198500590 X:137241949-137241971 TACTTTACAAGAAAACTTGTAGG - Intergenic
1201489750 Y:14526856-14526878 AAATTTACAAGCAGACTTGAAGG + Intronic