ID: 1021743187 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:23709535-23709557 |
Sequence | CCTCAAAGTTTCCTCATGCC CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1021743187_1021743191 | 7 | Left | 1021743187 | 7:23709535-23709557 | CCGGGCATGAGGAAACTTTGAGG | No data | ||
Right | 1021743191 | 7:23709565-23709587 | AAAGTTTATCTTAATTGTGGAGG | No data | ||||
1021743187_1021743190 | 4 | Left | 1021743187 | 7:23709535-23709557 | CCGGGCATGAGGAAACTTTGAGG | No data | ||
Right | 1021743190 | 7:23709562-23709584 | GGAAAAGTTTATCTTAATTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1021743187 | Original CRISPR | CCTCAAAGTTTCCTCATGCC CGG (reversed) | Intergenic | ||