ID: 1021743187

View in Genome Browser
Species Human (GRCh38)
Location 7:23709535-23709557
Sequence CCTCAAAGTTTCCTCATGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021743187_1021743191 7 Left 1021743187 7:23709535-23709557 CCGGGCATGAGGAAACTTTGAGG No data
Right 1021743191 7:23709565-23709587 AAAGTTTATCTTAATTGTGGAGG No data
1021743187_1021743190 4 Left 1021743187 7:23709535-23709557 CCGGGCATGAGGAAACTTTGAGG No data
Right 1021743190 7:23709562-23709584 GGAAAAGTTTATCTTAATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021743187 Original CRISPR CCTCAAAGTTTCCTCATGCC CGG (reversed) Intergenic