ID: 1021743191

View in Genome Browser
Species Human (GRCh38)
Location 7:23709565-23709587
Sequence AAAGTTTATCTTAATTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021743187_1021743191 7 Left 1021743187 7:23709535-23709557 CCGGGCATGAGGAAACTTTGAGG No data
Right 1021743191 7:23709565-23709587 AAAGTTTATCTTAATTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021743191 Original CRISPR AAAGTTTATCTTAATTGTGG AGG Intergenic