ID: 1021743982

View in Genome Browser
Species Human (GRCh38)
Location 7:23719721-23719743
Sequence CTGAAATATCCTCACTTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 5, 2: 3, 3: 9, 4: 168}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021743977_1021743982 28 Left 1021743977 7:23719670-23719692 CCACCCACTGGTATAAAACAGAT No data
Right 1021743982 7:23719721-23719743 CTGAAATATCCTCACTTACTTGG 0: 1
1: 5
2: 3
3: 9
4: 168
1021743978_1021743982 25 Left 1021743978 7:23719673-23719695 CCCACTGGTATAAAACAGATACC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1021743982 7:23719721-23719743 CTGAAATATCCTCACTTACTTGG 0: 1
1: 5
2: 3
3: 9
4: 168
1021743975_1021743982 30 Left 1021743975 7:23719668-23719690 CCCCACCCACTGGTATAAAACAG No data
Right 1021743982 7:23719721-23719743 CTGAAATATCCTCACTTACTTGG 0: 1
1: 5
2: 3
3: 9
4: 168
1021743980_1021743982 4 Left 1021743980 7:23719694-23719716 CCTTCCATGAAAGTATCTTTCAC No data
Right 1021743982 7:23719721-23719743 CTGAAATATCCTCACTTACTTGG 0: 1
1: 5
2: 3
3: 9
4: 168
1021743981_1021743982 0 Left 1021743981 7:23719698-23719720 CCATGAAAGTATCTTTCACATTA 0: 1
1: 0
2: 1
3: 27
4: 368
Right 1021743982 7:23719721-23719743 CTGAAATATCCTCACTTACTTGG 0: 1
1: 5
2: 3
3: 9
4: 168
1021743976_1021743982 29 Left 1021743976 7:23719669-23719691 CCCACCCACTGGTATAAAACAGA 0: 1
1: 0
2: 8
3: 14
4: 119
Right 1021743982 7:23719721-23719743 CTGAAATATCCTCACTTACTTGG 0: 1
1: 5
2: 3
3: 9
4: 168
1021743979_1021743982 24 Left 1021743979 7:23719674-23719696 CCACTGGTATAAAACAGATACCT 0: 1
1: 1
2: 1
3: 21
4: 195
Right 1021743982 7:23719721-23719743 CTGAAATATCCTCACTTACTTGG 0: 1
1: 5
2: 3
3: 9
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021743982 Original CRISPR CTGAAATATCCTCACTTACT TGG Intronic