ID: 1021744111

View in Genome Browser
Species Human (GRCh38)
Location 7:23721657-23721679
Sequence GACTCCCTCCCTGTGCTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 236}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021744111_1021744117 26 Left 1021744111 7:23721657-23721679 CCTGACAGCACAGGGAGGGAGTC 0: 1
1: 0
2: 0
3: 20
4: 236
Right 1021744117 7:23721706-23721728 TTCTTACTTGGCTGCACAAGTGG 0: 1
1: 1
2: 0
3: 6
4: 157
1021744111_1021744115 14 Left 1021744111 7:23721657-23721679 CCTGACAGCACAGGGAGGGAGTC 0: 1
1: 0
2: 0
3: 20
4: 236
Right 1021744115 7:23721694-23721716 TTACCATTATCATTCTTACTTGG 0: 1
1: 1
2: 1
3: 32
4: 232
1021744111_1021744112 -10 Left 1021744111 7:23721657-23721679 CCTGACAGCACAGGGAGGGAGTC 0: 1
1: 0
2: 0
3: 20
4: 236
Right 1021744112 7:23721670-23721692 GGAGGGAGTCCCACAGAATCTGG 0: 1
1: 0
2: 0
3: 18
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021744111 Original CRISPR GACTCCCTCCCTGTGCTGTC AGG (reversed) Intronic
900204364 1:1425814-1425836 GCCTCCCTCCCTGTGCCGGGCGG - Intergenic
900331688 1:2137949-2137971 GCCGCCCTCCCTGAGCAGTCAGG - Intronic
901151038 1:7101443-7101465 GATTCTCCCCCTGTGCTGTTTGG + Intronic
901492889 1:9605624-9605646 GACTCCCTCACTGTGATATGTGG - Intronic
902227838 1:15007904-15007926 GGCTCCCTTCCTGTGCTGATGGG - Intronic
902736552 1:18405187-18405209 TACTCCCTCACTGTGCTTCCTGG + Intergenic
903368211 1:22817887-22817909 GACTCCATCCCTGAGCTTCCTGG + Intronic
906534786 1:46545423-46545445 CACTCCCTCCCTGTGGTCACAGG - Intergenic
907251232 1:53141315-53141337 GACCCCCTCCCTCTGCTCGCTGG + Intronic
911194601 1:94981017-94981039 GAATGCCTCTCTGTGCTGTGGGG - Exonic
911546006 1:99217779-99217801 GGCTCTCGCCCTTTGCTGTCAGG + Intergenic
913379659 1:118195494-118195516 TTCTCCCTCCCTGTTCAGTCTGG + Intergenic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
915062488 1:153197649-153197671 GACTCCCCACCTGTTCTGCCGGG - Intergenic
915742043 1:158126152-158126174 GTCTCTCTCACTGTGCTGTATGG + Intergenic
917233611 1:172865320-172865342 GCCTCACTCCCTTTGCTTTCTGG + Intergenic
917262935 1:173189311-173189333 AACTCCCTCCCAGTGCATTCTGG - Intronic
918802328 1:188987187-188987209 CACTACCTCCCTTGGCTGTCAGG + Intergenic
920044252 1:203123385-203123407 CACTGCCTCCCTCTGCTGTAAGG + Intronic
922625137 1:227032731-227032753 AACTCCCTCCATGTGGTCTCTGG - Intronic
922685180 1:227633342-227633364 GTCCCTCTCCCTGTGCTCTCAGG + Intronic
923160487 1:231310548-231310570 GATGCCCTCCCTGAGCTCTCAGG + Intergenic
1064279349 10:13937072-13937094 GCAACCCTCCCTTTGCTGTCAGG - Intronic
1065251717 10:23822135-23822157 GTCTCCATCCCTTTCCTGTCAGG + Intronic
1065712648 10:28532826-28532848 GGCTCCCTCCCTGCGCAGCCCGG + Intronic
1066501665 10:36000922-36000944 GTCTCCCTCCCTCTGGTCTCTGG + Intergenic
1066629514 10:37445251-37445273 GTCTCCCTCCCTCTGGTCTCTGG + Intergenic
1069076796 10:64045484-64045506 GTCCCCCGCCCTGTGCTCTCAGG - Intergenic
1069826805 10:71259743-71259765 CACTCCCTCCCTGTGGGGCCTGG - Intronic
1071601471 10:86960534-86960556 GCCTCCCTCCCTGGGCTGGGCGG + Intronic
1072552102 10:96486938-96486960 GGCTCCCACCCTTTGGTGTCAGG - Intronic
1073428094 10:103468527-103468549 TTCTCCCTGCCTGTGCTGACTGG - Intergenic
1074292054 10:112144999-112145021 GGCCCCCTCCCTCTGCAGTCAGG - Intergenic
1074946967 10:118289503-118289525 GACTTTCTCCCTGTTCTGTCAGG - Intergenic
1076597591 10:131634922-131634944 CGCTCCCTCCCTCTGCTGTCTGG - Intergenic
1076754937 10:132564461-132564483 GGCTGCCTCCCTGGGCTGTGCGG + Intronic
1076760594 10:132604084-132604106 CTGTCCCGCCCTGTGCTGTCAGG + Intronic
1077538141 11:3134232-3134254 GAGGCCCTTCCTGTCCTGTCTGG - Intronic
1077575458 11:3379360-3379382 GGCTTCCTGCCTGCGCTGTCCGG + Intergenic
1081542731 11:44048052-44048074 GACACCCTTCCTGTGCCCTCTGG + Exonic
1083631379 11:64097209-64097231 CAGTCCCTCCCTGTACTTTCTGG - Intronic
1083758917 11:64805389-64805411 GACTCCCTCCCTCAGCTGAGGGG - Intronic
1084689286 11:70715835-70715857 GACTCCAGCCCTGGGCTGCCGGG - Intronic
1085524519 11:77156642-77156664 CACTCCCTCCCTCTGCAGTGGGG + Exonic
1086305819 11:85481487-85481509 GTATCTCTCCCTGTGCTGCCTGG - Intronic
1088701497 11:112417061-112417083 AAATCCCTTCCTGTGATGTCTGG + Intergenic
1089946631 11:122480446-122480468 GTCTCTCTCTTTGTGCTGTCTGG - Intergenic
1090256708 11:125289569-125289591 CACTCTCTCCCTGAGCTTTCAGG + Intronic
1090330269 11:125926008-125926030 GCCTCTCTCTCTCTGCTGTCTGG - Intergenic
1091657889 12:2359173-2359195 CACTCCTTCCCTTTGCTCTCTGG + Intronic
1091799196 12:3314065-3314087 GCCTCCCTGCCTTTGCTCTCTGG + Intergenic
1092128461 12:6091823-6091845 GGCTCCCTCCCTTTCCTGTTCGG - Intronic
1093781749 12:23145388-23145410 CACACACTCCATGTGCTGTCAGG - Intergenic
1094088567 12:26622304-26622326 GACTACCCGCCTTTGCTGTCTGG - Exonic
1095536919 12:43260408-43260430 GCCACCATCCCTGTGCTGTCAGG + Intergenic
1097203931 12:57304133-57304155 GCCTCCCTCCCTGAGTTATCAGG + Intronic
1097473705 12:60027344-60027366 GAGTCCCTCCCTGTGCTTGGGGG - Intergenic
1099798658 12:87429831-87429853 GTCTCTCCCCCTGTGCTCTCAGG + Intergenic
1100102056 12:91120972-91120994 GAGTCCCTCCCTGTGCTTGTGGG + Intergenic
1101477870 12:105067710-105067732 GGCTCCCTCCGTGTGCTCTTGGG - Intronic
1103339459 12:120213762-120213784 GTCTTCCTCATTGTGCTGTCTGG - Intronic
1104313400 12:127675228-127675250 GACTGCCTCCCTCTCTTGTCTGG - Intergenic
1104642730 12:130477847-130477869 GCCTCCCGCCCGGTGCTGGCTGG - Intronic
1105306029 13:19169799-19169821 CACTCCCCACCTGTGCAGTCCGG + Intergenic
1105307894 13:19181826-19181848 GCCTCCCGCCGTGCGCTGTCTGG + Exonic
1106542022 13:30698722-30698744 CAGTCCCTGCCTGTTCTGTCCGG + Intergenic
1106841244 13:33687095-33687117 GCCACCCTCCCTGTGCTGGTTGG + Intergenic
1108590262 13:51906700-51906722 GAGTGCCTGCCTGTGCTGGCAGG - Intergenic
1108746430 13:53399707-53399729 CACTCCCTCCATGAGATGTCTGG + Intergenic
1111091446 13:83452696-83452718 GCCTCCCTCCCTGAGCTCACTGG - Intergenic
1113625488 13:111793189-111793211 GGCTCCCTGCCTCTGCTGCCAGG + Intergenic
1114055038 14:18960647-18960669 GTCTCCCTCCTTTTTCTGTCTGG + Intergenic
1114107503 14:19441131-19441153 GTCTCCCTCCTTTTTCTGTCTGG - Intergenic
1114650385 14:24280936-24280958 CACTCCCTCCCGGTGCTGCGAGG - Intergenic
1115437761 14:33395691-33395713 AGCTCCCTCCTTGTTCTGTCAGG + Intronic
1116591187 14:46775901-46775923 TGCTCCCTCCCAGTGCAGTCTGG + Intergenic
1117913795 14:60657101-60657123 AACTCCCTCCCCGGGCTGTGCGG + Intronic
1118593547 14:67419265-67419287 TACTCCCTTCCTGTGCTGGGGGG - Intergenic
1119073129 14:71607644-71607666 GAGTCCCTCCCTTTGCTTTCAGG + Intronic
1119309592 14:73634577-73634599 GATTCCCTCACTCTGCTGTCAGG - Intergenic
1119618045 14:76111762-76111784 GCCTCCCTCCGTGTGCTCTTGGG + Intergenic
1119715015 14:76853014-76853036 GACTCCCTCCCTTTGGCTTCTGG - Intronic
1121278584 14:92684776-92684798 GAGTCCAGCCCTGAGCTGTCTGG - Intronic
1121322321 14:92999273-92999295 GCCACCCTCTCTGTGCTGTGGGG - Intronic
1122514470 14:102297598-102297620 GAGCCCCTCCCTGGGCTGGCCGG + Intronic
1123003167 14:105307450-105307472 CACCCCCTCCCTGTCCTGACTGG + Exonic
1123053819 14:105560061-105560083 AACCCCCACCCTGGGCTGTCTGG - Intergenic
1123058950 14:105585827-105585849 GGCTGCCTCCCTCTGCTCTCAGG - Intergenic
1123078402 14:105680478-105680500 AACCCCCACCCTGGGCTGTCTGG - Intergenic
1123083278 14:105706058-105706080 GGCTGCCTCCCTCTGCTCTCAGG - Intergenic
1124078740 15:26471305-26471327 GAGTCCCTCCCTGTGCTTGCGGG + Intergenic
1128529108 15:68431957-68431979 GAGTCCCTCCCTGGGCCCTCGGG - Intronic
1128548778 15:68584500-68584522 CACTCCATCCCTGAGCTGCCAGG - Intronic
1128831238 15:70771188-70771210 GATTTCCTCCCTTTGTTGTCAGG - Intergenic
1128869591 15:71143604-71143626 AACTCCCTGCCTGTGCAGCCTGG - Intronic
1130059735 15:80560835-80560857 GCCTCCTCCCCTGTGGTGTCAGG + Intronic
1131829292 15:96344084-96344106 GACTCCCTCCCTTCTCTTTCTGG + Intergenic
1132852088 16:2029389-2029411 GGCTCCCTCCCTCTGCACTCAGG - Intronic
1134848317 16:17460048-17460070 GCCTCCCTCCCTGGGTTGTGAGG - Intronic
1136076969 16:27823803-27823825 TAGTCCTTCCCTGTGCTGTGTGG - Intronic
1136537745 16:30910400-30910422 CACCCGCTCCCTGTCCTGTCTGG - Intergenic
1138434177 16:56988156-56988178 GACCCGCTCCCTGTGCAGGCAGG - Intergenic
1142312153 16:89320440-89320462 GACTCACGCCCTGTGCTGAGCGG + Intronic
1142617338 17:1143957-1143979 GACAACCTCCCTGGGCTGTGGGG - Intronic
1142855308 17:2725928-2725950 GACTCCCTTCCTGTGCACACTGG - Intergenic
1143054766 17:4154661-4154683 GTCACCCTCCCTGTGATGACAGG - Exonic
1143671462 17:8398959-8398981 GATTCCCTCCCAGTCCTCTCAGG + Intergenic
1146922500 17:36722862-36722884 GTGTCCCACCCTGTGCTGTTGGG + Intergenic
1147572506 17:41580025-41580047 TAGTCCCACCCTGTGCTGTCAGG - Intergenic
1147608257 17:41786264-41786286 GACTCTCGCCCTGGGCTGGCGGG - Intronic
1147884417 17:43675210-43675232 GACTCCAGCCCTGGGCTGCCGGG - Intergenic
1148020038 17:44547639-44547661 GACCCCCTCCCTGAGATGTGGGG - Intergenic
1149511324 17:57244021-57244043 GGCTGCCTCCCAGTGCTGCCTGG - Intergenic
1150218647 17:63483827-63483849 GACTCCCACCCTGTGCCTGCAGG + Intergenic
1151503817 17:74512909-74512931 GCCTACCACCCTGAGCTGTCAGG + Intergenic
1151730831 17:75910218-75910240 GGTGCCCTCCCTGTACTGTCAGG + Intronic
1152678406 17:81653346-81653368 GACTCCCTCCTGCTGCGGTCTGG + Exonic
1153518986 18:5934295-5934317 GCATCCCTCCCTGTCCAGTCAGG - Intergenic
1153950651 18:10054991-10055013 GACCCCATCACTGTGCTGACTGG + Intergenic
1155128125 18:22900996-22901018 GTCTCCCTGCCAGTGCTGCCTGG - Intronic
1160412848 18:78686723-78686745 CACACCCTCCCTGTGCTGTGTGG + Intergenic
1163394891 19:17054108-17054130 GGCTCCCTCCAGGGGCTGTCAGG - Intronic
1163676279 19:18656795-18656817 CACTCCCGCCCTGTGCTGGGAGG - Intronic
1163713847 19:18862910-18862932 GGCTCTCTCCCTGTGCTGGGTGG - Intronic
1164575131 19:29401459-29401481 GCCTCCCACTCTGGGCTGTCTGG - Intergenic
1164757819 19:30703366-30703388 CACTGCCTCCCAGTGCTGTTTGG + Intronic
1166671239 19:44710661-44710683 CACTCCCTCGCTGAGCTGTTGGG + Exonic
925112431 2:1347556-1347578 GTCTCTCTCCATGTCCTGTCAGG + Intronic
925189352 2:1870351-1870373 AGCTCCCTCCCTGTTCTGTGTGG + Intronic
927096246 2:19749710-19749732 TCCTTCCTCCCTGAGCTGTCAGG + Intergenic
927125768 2:20011763-20011785 GTTTCCCTTCATGTGCTGTCAGG + Intronic
927640372 2:24841875-24841897 GCCTCCCTCCCTGTGGTGCCTGG + Intronic
927720016 2:25376584-25376606 GACTCCATCCGTGTGCGGCCAGG + Intergenic
927917785 2:26947813-26947835 CACCCCTGCCCTGTGCTGTCTGG - Exonic
927939804 2:27096324-27096346 GACCCCCTGCCTGGGCTGTCTGG - Intronic
929075209 2:38075006-38075028 GCCTCCTTCCGTGTGGTGTCCGG - Exonic
929287317 2:40150017-40150039 GACTCCCTCTCTCTGTTCTCAGG + Intronic
929357313 2:41041344-41041366 GGCTCTCTTCCTGTTCTGTCGGG - Intergenic
931435635 2:62243742-62243764 AACTCCCACCCTGTGCTCTGGGG + Intergenic
932103433 2:68922081-68922103 GACTCCCTCTCTGCCCTCTCTGG - Intergenic
933371074 2:81416292-81416314 GACTTCCAGCCTGTGCTGGCTGG + Intergenic
934504428 2:94879796-94879818 CCCTCCCTCCCTGAACTGTCGGG - Intergenic
935732095 2:106072785-106072807 GGCCCCCTCCCTGTGCTGTGTGG + Intronic
938473049 2:131583434-131583456 GTCTCCCTCCTTTTTCTGTCTGG + Intergenic
941379553 2:164776134-164776156 GTCTCCCTGCCTCTGCTCTCAGG + Intronic
945312387 2:208329508-208329530 GAGTCCCACCTTGTGCTGACAGG + Intronic
946334083 2:219025988-219026010 GTCTCCCTCCCACTGCTGTTGGG + Intronic
947897402 2:233688433-233688455 GACTGCCTCCCTGTGTTGACAGG + Intronic
948580013 2:238980625-238980647 GCCCCTCTCCCTGTGCTCTCAGG + Intergenic
1172771825 20:37386555-37386577 CACTCCCTGCCTGTGATCTCTGG + Intronic
1173474965 20:43352510-43352532 TTCTCCTTCCCTGTGCTTTCTGG - Intergenic
1173820752 20:46018750-46018772 TACTCATTCCCTGTGATGTCTGG + Intergenic
1174306199 20:49615916-49615938 GCCCTCCTCCCTGTGCTGTGTGG + Intergenic
1174348745 20:49951517-49951539 GCCTCCATTCGTGTGCTGTCTGG + Intronic
1174376539 20:50129935-50129957 GTCTCCCTACCTGTGCTGTAAGG + Intronic
1175175130 20:57106935-57106957 GACTTCCTCCCTGAGCTGTGGGG - Intergenic
1175406234 20:58731598-58731620 TACCCACTCCCTGTGCTGTGGGG + Intergenic
1176214384 20:63941373-63941395 GTCGCCCTACCTGAGCTGTCAGG + Intronic
1179580617 21:42341255-42341277 CACTCCCTCCCTGTCTTGTCCGG - Intergenic
1179713271 21:43275017-43275039 CACTCCCTGCCTGGGCTGTCAGG + Intergenic
1180093768 21:45544973-45544995 CACTGCCTCCCTATGCTGACGGG - Intergenic
1180473519 22:15683197-15683219 GTCTCCCTCCTTTTTCTGTCTGG + Intergenic
1184149893 22:42631744-42631766 TCCTCCCTCCCCGTCCTGTCTGG - Intronic
1184279557 22:43429240-43429262 GATTCCCACCCAGTGCTGTGTGG + Intronic
1184676391 22:46045453-46045475 GCTTGCCTCCTTGTGCTGTCGGG - Intergenic
1184812815 22:46848322-46848344 CACTCCTTCCCTGTTCTCTCGGG - Intronic
950881704 3:16327796-16327818 GGCTCTCTCCCTGTGCTAGCAGG - Intronic
952115319 3:30173013-30173035 GACTCCATCCATGTGCCTTCTGG + Intergenic
955390795 3:58520967-58520989 GTCTCCCTCCCAGGGCTGTGTGG + Intronic
956871519 3:73422699-73422721 GACTCCCTCCCTTTCCTCTTTGG + Intronic
956974320 3:74562751-74562773 GACTTCCTCCCTGCTCTGCCTGG + Intergenic
961382258 3:126503524-126503546 CACTCCCTCCCTGTGCTCCAGGG - Intronic
961723700 3:128912155-128912177 GACACCCCCCCAGTGCTGACAGG + Intronic
962167381 3:133063518-133063540 AACCCTTTCCCTGTGCTGTCTGG - Intronic
962519181 3:136182512-136182534 TTCTCCCTCCCTGTGCTTTTTGG - Intronic
966041508 3:175495551-175495573 CACTTTCTTCCTGTGCTGTCAGG + Intronic
968939369 4:3630175-3630197 GGCTCCTTCCCTGTGCCTTCCGG + Intergenic
969593367 4:8134224-8134246 AACTCCCTTCCTGAGCTCTCAGG + Intronic
970350278 4:15195310-15195332 CACTCCCTCACTGTGCTTTTGGG - Intergenic
973870049 4:55157599-55157621 GTCTCCTTCCCTGGGCCGTCAGG + Intergenic
981361720 4:143853555-143853577 GACTCCCTTACTGTATTGTCTGG + Intergenic
981372445 4:143974459-143974481 GACTCCCTTACTGTATTGTCTGG + Intergenic
983053704 4:163078115-163078137 GAGTCCCTCTCGGTGCTGTGAGG + Intergenic
986213779 5:5699036-5699058 CTCTCCCTCCCTGTGCAGACTGG + Intergenic
987162695 5:15160655-15160677 GACTCCCTCCCTCTGCTGGAGGG - Intergenic
987712601 5:21521689-21521711 GAGTGCCTCACTGAGCTGTCGGG - Intergenic
988689817 5:33561048-33561070 ACCTCCGTCCCTGTGCTGGCTGG - Exonic
992029719 5:72709198-72709220 GCCTCCCTCCCTGAGCTCACTGG + Intergenic
992404850 5:76447347-76447369 GTCCCTCTCCCTGTGCTCTCAGG - Intronic
992493365 5:77267520-77267542 AGCTCCCTCCCTGTGCTGGAAGG + Intronic
994626494 5:102226550-102226572 GACTCCCTCTCTTTGCAGTAGGG + Intergenic
996898781 5:128519781-128519803 TACTCCTTCCCTGTGCTACCGGG - Intronic
996915132 5:128703249-128703271 GGCTTCCTGCTTGTGCTGTCTGG - Intronic
997786644 5:136719517-136719539 GACTCCCTCCCCCAGCTGCCTGG - Intergenic
998012933 5:138709658-138709680 GTCTCCCTTCCTCTGCTGCCCGG + Intronic
999197190 5:149790414-149790436 CACACCCTCCCTGTGCAGACAGG + Intronic
999371157 5:151056231-151056253 GAAAGCCTCCCTGTGCTGTGGGG - Intronic
999698698 5:154208304-154208326 GAATCCTTCACTGTGCTCTCAGG - Intronic
1002308858 5:178301740-178301762 GTCTCCCACTCTGTGCTGGCGGG + Intronic
1002890800 6:1330157-1330179 GTCTCTCCCCCTGTGCTCTCAGG + Intergenic
1003581215 6:7342472-7342494 GACACCCTTCCTGTGCCATCTGG - Intronic
1004634828 6:17456690-17456712 GGCCCCTTCCCTTTGCTGTCTGG + Intronic
1006470901 6:34227968-34227990 GGCTCCCTCCCACCGCTGTCTGG - Intergenic
1007910610 6:45510021-45510043 GACTGCTTTCCTGTGCTGTAAGG + Intronic
1007930931 6:45689983-45690005 CACTTGCTCCCTGTGCTGTCAGG + Intergenic
1008357722 6:50574554-50574576 AACTCCATTCCTGTGATGTCTGG + Intergenic
1008741488 6:54614708-54614730 CACTGCCTCCCTTGGCTGTCGGG - Intergenic
1013087880 6:106871943-106871965 GGCTCCCTCCCTCTGCCTTCCGG - Intergenic
1015881104 6:137870694-137870716 CACTCCCTCCCTATGCTGGAAGG - Intronic
1016424599 6:143920878-143920900 GAGTCTCTCGCTGTGTTGTCAGG - Intronic
1019256740 7:57277-57299 GACTCCATCCCTGTGCCTCCTGG + Intergenic
1019339086 7:499920-499942 ATCTCAATCCCTGTGCTGTCTGG + Intronic
1021558608 7:21946129-21946151 CACTCCCTCCCTCTGCTGCAGGG - Intergenic
1021744111 7:23721657-23721679 GACTCCCTCCCTGTGCTGTCAGG - Intronic
1024660098 7:51485288-51485310 GACTCACTTCCTGTGCTGGGTGG + Intergenic
1024986831 7:55201334-55201356 GACTCCCCTCCTGAGCTCTCTGG + Exonic
1028988586 7:97026424-97026446 AACTCCCTGCCTTTGCGGTCTGG + Intergenic
1033410618 7:141114481-141114503 GACTTCATGCCTGTGCTATCTGG + Intronic
1034838771 7:154376085-154376107 GCCTCTCACCGTGTGCTGTCTGG - Intronic
1035232342 7:157472824-157472846 GACTCCCTCTCTGTTGTCTCTGG + Intergenic
1035275964 7:157748104-157748126 GCCTGCGTCCCTGAGCTGTCTGG + Intronic
1036737374 8:11330615-11330637 GACCCCAGCCCTGTGCTCTCTGG + Intergenic
1036798486 8:11772544-11772566 GACTCCATCTCTGTGCTTCCAGG + Intronic
1040832392 8:51691815-51691837 GCCTTCCTCCCTCTGCTGGCCGG - Intronic
1040976077 8:53195677-53195699 GTCTTTCTCCCTGTGCTGTTGGG + Intergenic
1041471901 8:58219966-58219988 GTCTGCCAGCCTGTGCTGTCCGG + Intergenic
1042773179 8:72400801-72400823 TACTCCCTCCAACTGCTGTCAGG - Intergenic
1045283684 8:100771802-100771824 GACTCCCTGCCTTTGAGGTCTGG + Intergenic
1045346060 8:101294734-101294756 CACTTTCTCCCTGTGCTATCAGG + Intergenic
1046889983 8:119412102-119412124 GACTGCCTCCCTGTCCTGCCTGG - Intergenic
1051966701 9:22836582-22836604 GACTCCTTCCATCTGCTTTCAGG - Intergenic
1052372643 9:27683075-27683097 GTCTCCCTCACTGAGCAGTCAGG + Intergenic
1054451391 9:65405149-65405171 GGCTCCTTCCCTGTGCCTTCCGG - Intergenic
1055010724 9:71561957-71561979 GGCTCCCTCCCTGGGGTGTGAGG - Intergenic
1056485224 9:87049869-87049891 CCCTCCCTCCCTCTGCTTTCTGG + Intergenic
1056778603 9:89532730-89532752 GACTCCATCCCTATGCAGTATGG - Intergenic
1057018550 9:91677778-91677800 GAGTCCCTCCCTTTCCTCTCTGG + Intronic
1059506308 9:114802848-114802870 GCCTCCTTCCCTGTGCATTCAGG - Intronic
1060732289 9:126046405-126046427 GCCAGCCTCCCTGTGGTGTCAGG - Intergenic
1061195201 9:129103556-129103578 GCCTTCCTCCCAGGGCTGTCTGG + Intronic
1061498700 9:130990244-130990266 GAGTCCCTCCCCGTGCTCTTGGG + Intergenic
1061634919 9:131901550-131901572 CACTGCCTCACTGAGCTGTCTGG + Intronic
1062305230 9:135902389-135902411 GTCTTCCTCCCTGTGTTGGCAGG - Intronic
1062468089 9:136690321-136690343 CACTCGCTCCCTGAGCTGTGTGG - Intergenic
1062587505 9:137255827-137255849 GCGTGCCTCCCTGTGCTCTCAGG + Intronic
1188526000 X:31088500-31088522 GCCTCGCTCCCTGAGCTGCCTGG + Intergenic
1189640698 X:43067814-43067836 GAGTCTCTCCCAGAGCTGTCTGG - Intergenic
1189676149 X:43462656-43462678 CACTCCCTCACTGTGCTCTTTGG - Intergenic
1189724637 X:43955753-43955775 GACTCCCTCTCAGTCCTTTCCGG + Intronic
1189954303 X:46262192-46262214 GTCCCTCCCCCTGTGCTGTCAGG + Intergenic
1190713887 X:53088248-53088270 GCCCCTCTCCCTGTGCTGTGTGG + Exonic
1192181147 X:68916524-68916546 GACTCCCTTCATGAGCTGCCTGG + Intergenic
1197290111 X:124645316-124645338 GATTCCTGCCCTGTGCTGTGTGG - Exonic
1197531633 X:127635421-127635443 GACTCCCTCACTGTGCTCATTGG + Intergenic
1198404615 X:136300277-136300299 GGCTCACTCCCTGTGCAGTCGGG - Intergenic
1199505450 X:148556071-148556093 GGCTCTCTCCCTCTGCTCTCTGG - Intronic
1199783931 X:151087245-151087267 GACTCCATCACTGGGTTGTCTGG + Intergenic