ID: 1021761366

View in Genome Browser
Species Human (GRCh38)
Location 7:23905256-23905278
Sequence ATTGAGAGGTGACAGCATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021761366_1021761375 21 Left 1021761366 7:23905256-23905278 CCAGCATGCTGTCACCTCTCAAT No data
Right 1021761375 7:23905300-23905322 CTTAAAGCTGTCCATAACCAAGG No data
1021761366_1021761369 -5 Left 1021761366 7:23905256-23905278 CCAGCATGCTGTCACCTCTCAAT No data
Right 1021761369 7:23905274-23905296 TCAATACCTCTCCTGGCTTCCGG No data
1021761366_1021761376 26 Left 1021761366 7:23905256-23905278 CCAGCATGCTGTCACCTCTCAAT No data
Right 1021761376 7:23905305-23905327 AGCTGTCCATAACCAAGGTGAGG No data
1021761366_1021761370 -4 Left 1021761366 7:23905256-23905278 CCAGCATGCTGTCACCTCTCAAT No data
Right 1021761370 7:23905275-23905297 CAATACCTCTCCTGGCTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021761366 Original CRISPR ATTGAGAGGTGACAGCATGC TGG (reversed) Intergenic