ID: 1021761366 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:23905256-23905278 |
Sequence | ATTGAGAGGTGACAGCATGC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1021761366_1021761375 | 21 | Left | 1021761366 | 7:23905256-23905278 | CCAGCATGCTGTCACCTCTCAAT | No data | ||
Right | 1021761375 | 7:23905300-23905322 | CTTAAAGCTGTCCATAACCAAGG | No data | ||||
1021761366_1021761369 | -5 | Left | 1021761366 | 7:23905256-23905278 | CCAGCATGCTGTCACCTCTCAAT | No data | ||
Right | 1021761369 | 7:23905274-23905296 | TCAATACCTCTCCTGGCTTCCGG | No data | ||||
1021761366_1021761376 | 26 | Left | 1021761366 | 7:23905256-23905278 | CCAGCATGCTGTCACCTCTCAAT | No data | ||
Right | 1021761376 | 7:23905305-23905327 | AGCTGTCCATAACCAAGGTGAGG | No data | ||||
1021761366_1021761370 | -4 | Left | 1021761366 | 7:23905256-23905278 | CCAGCATGCTGTCACCTCTCAAT | No data | ||
Right | 1021761370 | 7:23905275-23905297 | CAATACCTCTCCTGGCTTCCGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1021761366 | Original CRISPR | ATTGAGAGGTGACAGCATGC TGG (reversed) | Intergenic | ||