ID: 1021761368

View in Genome Browser
Species Human (GRCh38)
Location 7:23905270-23905292
Sequence AAGCCAGGAGAGGTATTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021761368_1021761375 7 Left 1021761368 7:23905270-23905292 CCTCTCAATACCTCTCCTGGCTT No data
Right 1021761375 7:23905300-23905322 CTTAAAGCTGTCCATAACCAAGG No data
1021761368_1021761376 12 Left 1021761368 7:23905270-23905292 CCTCTCAATACCTCTCCTGGCTT No data
Right 1021761376 7:23905305-23905327 AGCTGTCCATAACCAAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021761368 Original CRISPR AAGCCAGGAGAGGTATTGAG AGG (reversed) Intergenic