ID: 1021761371

View in Genome Browser
Species Human (GRCh38)
Location 7:23905280-23905302
Sequence AAGGTCCCGGAAGCCAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021761371_1021761375 -3 Left 1021761371 7:23905280-23905302 CCTCTCCTGGCTTCCGGGACCTT No data
Right 1021761375 7:23905300-23905322 CTTAAAGCTGTCCATAACCAAGG No data
1021761371_1021761379 24 Left 1021761371 7:23905280-23905302 CCTCTCCTGGCTTCCGGGACCTT No data
Right 1021761379 7:23905327-23905349 GACAGTGAGCAGAAATAGAATGG No data
1021761371_1021761376 2 Left 1021761371 7:23905280-23905302 CCTCTCCTGGCTTCCGGGACCTT No data
Right 1021761376 7:23905305-23905327 AGCTGTCCATAACCAAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021761371 Original CRISPR AAGGTCCCGGAAGCCAGGAG AGG (reversed) Intergenic