ID: 1021761372

View in Genome Browser
Species Human (GRCh38)
Location 7:23905285-23905307
Sequence GCTTTAAGGTCCCGGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021761372_1021761376 -3 Left 1021761372 7:23905285-23905307 CCTGGCTTCCGGGACCTTAAAGC No data
Right 1021761376 7:23905305-23905327 AGCTGTCCATAACCAAGGTGAGG No data
1021761372_1021761379 19 Left 1021761372 7:23905285-23905307 CCTGGCTTCCGGGACCTTAAAGC No data
Right 1021761379 7:23905327-23905349 GACAGTGAGCAGAAATAGAATGG No data
1021761372_1021761375 -8 Left 1021761372 7:23905285-23905307 CCTGGCTTCCGGGACCTTAAAGC No data
Right 1021761375 7:23905300-23905322 CTTAAAGCTGTCCATAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021761372 Original CRISPR GCTTTAAGGTCCCGGAAGCC AGG (reversed) Intergenic
No off target data available for this crispr