ID: 1021761375

View in Genome Browser
Species Human (GRCh38)
Location 7:23905300-23905322
Sequence CTTAAAGCTGTCCATAACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021761368_1021761375 7 Left 1021761368 7:23905270-23905292 CCTCTCAATACCTCTCCTGGCTT No data
Right 1021761375 7:23905300-23905322 CTTAAAGCTGTCCATAACCAAGG No data
1021761372_1021761375 -8 Left 1021761372 7:23905285-23905307 CCTGGCTTCCGGGACCTTAAAGC No data
Right 1021761375 7:23905300-23905322 CTTAAAGCTGTCCATAACCAAGG No data
1021761371_1021761375 -3 Left 1021761371 7:23905280-23905302 CCTCTCCTGGCTTCCGGGACCTT No data
Right 1021761375 7:23905300-23905322 CTTAAAGCTGTCCATAACCAAGG No data
1021761366_1021761375 21 Left 1021761366 7:23905256-23905278 CCAGCATGCTGTCACCTCTCAAT No data
Right 1021761375 7:23905300-23905322 CTTAAAGCTGTCCATAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021761375 Original CRISPR CTTAAAGCTGTCCATAACCA AGG Intergenic