ID: 1021761379

View in Genome Browser
Species Human (GRCh38)
Location 7:23905327-23905349
Sequence GACAGTGAGCAGAAATAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021761372_1021761379 19 Left 1021761372 7:23905285-23905307 CCTGGCTTCCGGGACCTTAAAGC No data
Right 1021761379 7:23905327-23905349 GACAGTGAGCAGAAATAGAATGG No data
1021761371_1021761379 24 Left 1021761371 7:23905280-23905302 CCTCTCCTGGCTTCCGGGACCTT No data
Right 1021761379 7:23905327-23905349 GACAGTGAGCAGAAATAGAATGG No data
1021761373_1021761379 11 Left 1021761373 7:23905293-23905315 CCGGGACCTTAAAGCTGTCCATA No data
Right 1021761379 7:23905327-23905349 GACAGTGAGCAGAAATAGAATGG No data
1021761374_1021761379 5 Left 1021761374 7:23905299-23905321 CCTTAAAGCTGTCCATAACCAAG No data
Right 1021761379 7:23905327-23905349 GACAGTGAGCAGAAATAGAATGG No data
1021761377_1021761379 -7 Left 1021761377 7:23905311-23905333 CCATAACCAAGGTGAGGACAGTG No data
Right 1021761379 7:23905327-23905349 GACAGTGAGCAGAAATAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021761379 Original CRISPR GACAGTGAGCAGAAATAGAA TGG Intergenic