ID: 1021761939

View in Genome Browser
Species Human (GRCh38)
Location 7:23910724-23910746
Sequence TTCCCCAGTGTGTCCGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021761926_1021761939 30 Left 1021761926 7:23910671-23910693 CCCAGCAAAGCCATGAGGGGTGG No data
Right 1021761939 7:23910724-23910746 TTCCCCAGTGTGTCCGGAAGTGG No data
1021761935_1021761939 -5 Left 1021761935 7:23910706-23910728 CCTTGGAGACCTAACCTTTTCCC No data
Right 1021761939 7:23910724-23910746 TTCCCCAGTGTGTCCGGAAGTGG No data
1021761933_1021761939 2 Left 1021761933 7:23910699-23910721 CCCAGAGCCTTGGAGACCTAACC No data
Right 1021761939 7:23910724-23910746 TTCCCCAGTGTGTCCGGAAGTGG No data
1021761928_1021761939 29 Left 1021761928 7:23910672-23910694 CCAGCAAAGCCATGAGGGGTGGG No data
Right 1021761939 7:23910724-23910746 TTCCCCAGTGTGTCCGGAAGTGG No data
1021761934_1021761939 1 Left 1021761934 7:23910700-23910722 CCAGAGCCTTGGAGACCTAACCT No data
Right 1021761939 7:23910724-23910746 TTCCCCAGTGTGTCCGGAAGTGG No data
1021761931_1021761939 20 Left 1021761931 7:23910681-23910703 CCATGAGGGGTGGGGCTGCCCAG No data
Right 1021761939 7:23910724-23910746 TTCCCCAGTGTGTCCGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021761939 Original CRISPR TTCCCCAGTGTGTCCGGAAG TGG Intergenic
No off target data available for this crispr