ID: 1021762231

View in Genome Browser
Species Human (GRCh38)
Location 7:23913268-23913290
Sequence CCAAGGCCACATAGAGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021762231_1021762243 20 Left 1021762231 7:23913268-23913290 CCCCCTTCTCTATGTGGCCTTGG No data
Right 1021762243 7:23913311-23913333 AGCTGTTTGAGCTCCAGCCATGG No data
1021762231_1021762246 30 Left 1021762231 7:23913268-23913290 CCCCCTTCTCTATGTGGCCTTGG No data
Right 1021762246 7:23913321-23913343 GCTCCAGCCATGGCTAAAAGGGG 0: 223
1: 701
2: 1238
3: 1351
4: 1262
1021762231_1021762245 29 Left 1021762231 7:23913268-23913290 CCCCCTTCTCTATGTGGCCTTGG No data
Right 1021762245 7:23913320-23913342 AGCTCCAGCCATGGCTAAAAGGG 0: 181
1: 429
2: 981
3: 1484
4: 1529
1021762231_1021762244 28 Left 1021762231 7:23913268-23913290 CCCCCTTCTCTATGTGGCCTTGG No data
Right 1021762244 7:23913319-23913341 GAGCTCCAGCCATGGCTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021762231 Original CRISPR CCAAGGCCACATAGAGAAGG GGG (reversed) Intergenic
No off target data available for this crispr