ID: 1021763575

View in Genome Browser
Species Human (GRCh38)
Location 7:23924975-23924997
Sequence TTGGAAATGCAGCAGCATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021763575_1021763584 26 Left 1021763575 7:23924975-23924997 CCTAGATGCTGCTGCATTTCCAA No data
Right 1021763584 7:23925024-23925046 GGTCCATGGACCACGCTTTGAGG No data
1021763575_1021763580 2 Left 1021763575 7:23924975-23924997 CCTAGATGCTGCTGCATTTCCAA No data
Right 1021763580 7:23925000-23925022 CTCCTGGGTGATGCTGGTGTTGG No data
1021763575_1021763583 12 Left 1021763575 7:23924975-23924997 CCTAGATGCTGCTGCATTTCCAA No data
Right 1021763583 7:23925010-23925032 ATGCTGGTGTTGGAGGTCCATGG No data
1021763575_1021763582 5 Left 1021763575 7:23924975-23924997 CCTAGATGCTGCTGCATTTCCAA No data
Right 1021763582 7:23925003-23925025 CTGGGTGATGCTGGTGTTGGAGG No data
1021763575_1021763579 -4 Left 1021763575 7:23924975-23924997 CCTAGATGCTGCTGCATTTCCAA No data
Right 1021763579 7:23924994-23925016 CCAATGCTCCTGGGTGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021763575 Original CRISPR TTGGAAATGCAGCAGCATCT AGG (reversed) Intergenic
No off target data available for this crispr