ID: 1021764958

View in Genome Browser
Species Human (GRCh38)
Location 7:23939625-23939647
Sequence GTGGCTATAGCCAGGCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021764954_1021764958 20 Left 1021764954 7:23939582-23939604 CCAGGCATCTTGCTGATGTCACT No data
Right 1021764958 7:23939625-23939647 GTGGCTATAGCCAGGCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021764958 Original CRISPR GTGGCTATAGCCAGGCATGG TGG Intergenic
No off target data available for this crispr