ID: 1021767157 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:23961543-23961565 |
| Sequence | ATCATTACTCAAATGGGGTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1021767157_1021767161 | -4 | Left | 1021767157 | 7:23961543-23961565 | CCAGACCCCATTTGAGTAATGAT | No data | ||
| Right | 1021767161 | 7:23961562-23961584 | TGATAAAACTGTAAAGTAGTAGG | No data | ||||
| 1021767157_1021767162 | 5 | Left | 1021767157 | 7:23961543-23961565 | CCAGACCCCATTTGAGTAATGAT | No data | ||
| Right | 1021767162 | 7:23961571-23961593 | TGTAAAGTAGTAGGAAATCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1021767157 | Original CRISPR | ATCATTACTCAAATGGGGTC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||