ID: 1021767157

View in Genome Browser
Species Human (GRCh38)
Location 7:23961543-23961565
Sequence ATCATTACTCAAATGGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021767157_1021767161 -4 Left 1021767157 7:23961543-23961565 CCAGACCCCATTTGAGTAATGAT No data
Right 1021767161 7:23961562-23961584 TGATAAAACTGTAAAGTAGTAGG No data
1021767157_1021767162 5 Left 1021767157 7:23961543-23961565 CCAGACCCCATTTGAGTAATGAT No data
Right 1021767162 7:23961571-23961593 TGTAAAGTAGTAGGAAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021767157 Original CRISPR ATCATTACTCAAATGGGGTC TGG (reversed) Intergenic
No off target data available for this crispr