ID: 1021769275

View in Genome Browser
Species Human (GRCh38)
Location 7:23982685-23982707
Sequence CTGAATCTAAAGATTGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021769273_1021769275 1 Left 1021769273 7:23982661-23982683 CCTTATCAAAACAACCAAGCAAA No data
Right 1021769275 7:23982685-23982707 CTGAATCTAAAGATTGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021769275 Original CRISPR CTGAATCTAAAGATTGAGAA AGG Intergenic
No off target data available for this crispr