ID: 1021769330

View in Genome Browser
Species Human (GRCh38)
Location 7:23983158-23983180
Sequence TCCATGAGGTCCCGTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021769330_1021769334 3 Left 1021769330 7:23983158-23983180 CCTGCCTCACGGGACCTCATGGA No data
Right 1021769334 7:23983184-23983206 CAGCCAGATAACTCAGGCAGTGG No data
1021769330_1021769333 -3 Left 1021769330 7:23983158-23983180 CCTGCCTCACGGGACCTCATGGA No data
Right 1021769333 7:23983178-23983200 GGAAGTCAGCCAGATAACTCAGG No data
1021769330_1021769336 10 Left 1021769330 7:23983158-23983180 CCTGCCTCACGGGACCTCATGGA No data
Right 1021769336 7:23983191-23983213 ATAACTCAGGCAGTGGTCACAGG No data
1021769330_1021769337 27 Left 1021769330 7:23983158-23983180 CCTGCCTCACGGGACCTCATGGA No data
Right 1021769337 7:23983208-23983230 CACAGGTTGAGAGAAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021769330 Original CRISPR TCCATGAGGTCCCGTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr