ID: 1021773086

View in Genome Browser
Species Human (GRCh38)
Location 7:24024757-24024779
Sequence CAGGCTGAACAGATGGAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021773086_1021773095 15 Left 1021773086 7:24024757-24024779 CCGTGTTCCATCTGTTCAGCCTG No data
Right 1021773095 7:24024795-24024817 TCCAGCAGTCACTGTGTTCTGGG No data
1021773086_1021773094 14 Left 1021773086 7:24024757-24024779 CCGTGTTCCATCTGTTCAGCCTG No data
Right 1021773094 7:24024794-24024816 CTCCAGCAGTCACTGTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021773086 Original CRISPR CAGGCTGAACAGATGGAACA CGG (reversed) Intergenic
No off target data available for this crispr