ID: 1021775243

View in Genome Browser
Species Human (GRCh38)
Location 7:24048070-24048092
Sequence GTGAAATCCCTTACATTGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021775240_1021775243 4 Left 1021775240 7:24048043-24048065 CCTGTAATAGAAGTGTATTTTGG No data
Right 1021775243 7:24048070-24048092 GTGAAATCCCTTACATTGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021775243 Original CRISPR GTGAAATCCCTTACATTGAC GGG Intergenic
No off target data available for this crispr