ID: 1021786132

View in Genome Browser
Species Human (GRCh38)
Location 7:24154591-24154613
Sequence TATGCTGGACCATGCTAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021786128_1021786132 -7 Left 1021786128 7:24154575-24154597 CCCTCATCATTGCCACTATGCTG No data
Right 1021786132 7:24154591-24154613 TATGCTGGACCATGCTAAAGTGG No data
1021786129_1021786132 -8 Left 1021786129 7:24154576-24154598 CCTCATCATTGCCACTATGCTGG No data
Right 1021786132 7:24154591-24154613 TATGCTGGACCATGCTAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021786132 Original CRISPR TATGCTGGACCATGCTAAAG TGG Intergenic
No off target data available for this crispr