ID: 1021787697

View in Genome Browser
Species Human (GRCh38)
Location 7:24168867-24168889
Sequence TTATAGTTCTGTAGGTTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021787693_1021787697 -8 Left 1021787693 7:24168852-24168874 CCCAAATTTATTATTTTATAGTT No data
Right 1021787697 7:24168867-24168889 TTATAGTTCTGTAGGTTAGAGGG No data
1021787694_1021787697 -9 Left 1021787694 7:24168853-24168875 CCAAATTTATTATTTTATAGTTC No data
Right 1021787697 7:24168867-24168889 TTATAGTTCTGTAGGTTAGAGGG No data
1021787692_1021787697 16 Left 1021787692 7:24168828-24168850 CCACAAACTTGGAGGTTTAAATA No data
Right 1021787697 7:24168867-24168889 TTATAGTTCTGTAGGTTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021787697 Original CRISPR TTATAGTTCTGTAGGTTAGA GGG Intergenic
No off target data available for this crispr