ID: 1021802069

View in Genome Browser
Species Human (GRCh38)
Location 7:24316939-24316961
Sequence CTTCCAACTCAGATGGTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021802069_1021802071 14 Left 1021802069 7:24316939-24316961 CCTTGAACCATCTGAGTTGGAAG No data
Right 1021802071 7:24316976-24316998 AACCAATAATCTTTAAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021802069 Original CRISPR CTTCCAACTCAGATGGTTCA AGG (reversed) Intergenic
No off target data available for this crispr