ID: 1021811566

View in Genome Browser
Species Human (GRCh38)
Location 7:24406851-24406873
Sequence CTAGCTCTCCAGCACTACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021811566_1021811571 26 Left 1021811566 7:24406851-24406873 CCAGTGTAGTGCTGGAGAGCTAG No data
Right 1021811571 7:24406900-24406922 ACATCTTTTCACTAAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021811566 Original CRISPR CTAGCTCTCCAGCACTACAC TGG (reversed) Intergenic
No off target data available for this crispr