ID: 1021812719

View in Genome Browser
Species Human (GRCh38)
Location 7:24419031-24419053
Sequence ATCTGGATCTTTATGTGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021812719_1021812723 -4 Left 1021812719 7:24419031-24419053 CCCTCTCACATAAAGATCCAGAT No data
Right 1021812723 7:24419050-24419072 AGATATATGTGGTGCAGATCTGG No data
1021812719_1021812725 18 Left 1021812719 7:24419031-24419053 CCCTCTCACATAAAGATCCAGAT No data
Right 1021812725 7:24419072-24419094 GTAGAAATGCTCTGGTTGTCTGG No data
1021812719_1021812726 19 Left 1021812719 7:24419031-24419053 CCCTCTCACATAAAGATCCAGAT No data
Right 1021812726 7:24419073-24419095 TAGAAATGCTCTGGTTGTCTGGG No data
1021812719_1021812724 10 Left 1021812719 7:24419031-24419053 CCCTCTCACATAAAGATCCAGAT No data
Right 1021812724 7:24419064-24419086 CAGATCTGGTAGAAATGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021812719 Original CRISPR ATCTGGATCTTTATGTGAGA GGG (reversed) Intergenic
No off target data available for this crispr