ID: 1021814308

View in Genome Browser
Species Human (GRCh38)
Location 7:24432763-24432785
Sequence TAATTTACAAGAAGACTCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021814302_1021814308 30 Left 1021814302 7:24432710-24432732 CCATTGTCTATGCGCCTGTTATA No data
Right 1021814308 7:24432763-24432785 TAATTTACAAGAAGACTCGCGGG No data
1021814306_1021814308 -10 Left 1021814306 7:24432750-24432772 CCTTGTCACTTGTTAATTTACAA No data
Right 1021814308 7:24432763-24432785 TAATTTACAAGAAGACTCGCGGG No data
1021814305_1021814308 -9 Left 1021814305 7:24432749-24432771 CCCTTGTCACTTGTTAATTTACA No data
Right 1021814308 7:24432763-24432785 TAATTTACAAGAAGACTCGCGGG No data
1021814304_1021814308 16 Left 1021814304 7:24432724-24432746 CCTGTTATATGCAAGGCACTGCA No data
Right 1021814308 7:24432763-24432785 TAATTTACAAGAAGACTCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021814308 Original CRISPR TAATTTACAAGAAGACTCGC GGG Intergenic
No off target data available for this crispr