ID: 1021815444

View in Genome Browser
Species Human (GRCh38)
Location 7:24443085-24443107
Sequence CTGTGTGTCTGGCCCTCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021815439_1021815444 19 Left 1021815439 7:24443043-24443065 CCCAGAGATTACAGCCAATAAGT No data
Right 1021815444 7:24443085-24443107 CTGTGTGTCTGGCCCTCACAAGG No data
1021815441_1021815444 5 Left 1021815441 7:24443057-24443079 CCAATAAGTAGTTACCTATGAGA No data
Right 1021815444 7:24443085-24443107 CTGTGTGTCTGGCCCTCACAAGG No data
1021815438_1021815444 30 Left 1021815438 7:24443032-24443054 CCTTTCTATGGCCCAGAGATTAC No data
Right 1021815444 7:24443085-24443107 CTGTGTGTCTGGCCCTCACAAGG No data
1021815440_1021815444 18 Left 1021815440 7:24443044-24443066 CCAGAGATTACAGCCAATAAGTA No data
Right 1021815444 7:24443085-24443107 CTGTGTGTCTGGCCCTCACAAGG No data
1021815442_1021815444 -9 Left 1021815442 7:24443071-24443093 CCTATGAGAGTTGTCTGTGTGTC No data
Right 1021815444 7:24443085-24443107 CTGTGTGTCTGGCCCTCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021815444 Original CRISPR CTGTGTGTCTGGCCCTCACA AGG Intergenic
No off target data available for this crispr