ID: 1021815976

View in Genome Browser
Species Human (GRCh38)
Location 7:24448021-24448043
Sequence TTACCTGAGCGGGAGAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021815972_1021815976 3 Left 1021815972 7:24447995-24448017 CCACATAGGAGGCTGAGGTGCAA No data
Right 1021815976 7:24448021-24448043 TTACCTGAGCGGGAGAAGTCAGG No data
1021815970_1021815976 8 Left 1021815970 7:24447990-24448012 CCGAACCACATAGGAGGCTGAGG 0: 3
1: 9
2: 648
3: 17997
4: 230564
Right 1021815976 7:24448021-24448043 TTACCTGAGCGGGAGAAGTCAGG No data
1021815968_1021815976 16 Left 1021815968 7:24447982-24448004 CCTGTGATCCGAACCACATAGGA No data
Right 1021815976 7:24448021-24448043 TTACCTGAGCGGGAGAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021815976 Original CRISPR TTACCTGAGCGGGAGAAGTC AGG Intergenic
No off target data available for this crispr