ID: 1021819589

View in Genome Browser
Species Human (GRCh38)
Location 7:24483303-24483325
Sequence CTGCTTTGTGACTGCAATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021819585_1021819589 26 Left 1021819585 7:24483254-24483276 CCCTATTACTCTATACTAGTACT No data
Right 1021819589 7:24483303-24483325 CTGCTTTGTGACTGCAATGATGG No data
1021819586_1021819589 25 Left 1021819586 7:24483255-24483277 CCTATTACTCTATACTAGTACTA No data
Right 1021819589 7:24483303-24483325 CTGCTTTGTGACTGCAATGATGG No data
1021819584_1021819589 27 Left 1021819584 7:24483253-24483275 CCCCTATTACTCTATACTAGTAC No data
Right 1021819589 7:24483303-24483325 CTGCTTTGTGACTGCAATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021819589 Original CRISPR CTGCTTTGTGACTGCAATGA TGG Intergenic
No off target data available for this crispr