ID: 1021827445

View in Genome Browser
Species Human (GRCh38)
Location 7:24569760-24569782
Sequence GGCACTGGTTTACAAACCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021827445_1021827451 -1 Left 1021827445 7:24569760-24569782 CCAGCGGTTTGTAAACCAGTGCC No data
Right 1021827451 7:24569782-24569804 CAGTCGGGATGCTCAGAGCTGGG No data
1021827445_1021827452 4 Left 1021827445 7:24569760-24569782 CCAGCGGTTTGTAAACCAGTGCC No data
Right 1021827452 7:24569787-24569809 GGGATGCTCAGAGCTGGGAACGG No data
1021827445_1021827453 15 Left 1021827445 7:24569760-24569782 CCAGCGGTTTGTAAACCAGTGCC No data
Right 1021827453 7:24569798-24569820 AGCTGGGAACGGTGATCTTCAGG No data
1021827445_1021827450 -2 Left 1021827445 7:24569760-24569782 CCAGCGGTTTGTAAACCAGTGCC No data
Right 1021827450 7:24569781-24569803 CCAGTCGGGATGCTCAGAGCTGG No data
1021827445_1021827454 23 Left 1021827445 7:24569760-24569782 CCAGCGGTTTGTAAACCAGTGCC No data
Right 1021827454 7:24569806-24569828 ACGGTGATCTTCAGGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021827445 Original CRISPR GGCACTGGTTTACAAACCGC TGG (reversed) Intergenic