ID: 1021827448

View in Genome Browser
Species Human (GRCh38)
Location 7:24569775-24569797
Sequence CTGAGCATCCCGACTGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021827448_1021827455 22 Left 1021827448 7:24569775-24569797 CCAGTGCCAGTCGGGATGCTCAG No data
Right 1021827455 7:24569820-24569842 GCAGCCAGGTGAGACTAATCTGG No data
1021827448_1021827453 0 Left 1021827448 7:24569775-24569797 CCAGTGCCAGTCGGGATGCTCAG No data
Right 1021827453 7:24569798-24569820 AGCTGGGAACGGTGATCTTCAGG No data
1021827448_1021827454 8 Left 1021827448 7:24569775-24569797 CCAGTGCCAGTCGGGATGCTCAG No data
Right 1021827454 7:24569806-24569828 ACGGTGATCTTCAGGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021827448 Original CRISPR CTGAGCATCCCGACTGGCAC TGG (reversed) Intergenic
No off target data available for this crispr