ID: 1021827449

View in Genome Browser
Species Human (GRCh38)
Location 7:24569781-24569803
Sequence CCAGCTCTGAGCATCCCGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021827449_1021827453 -6 Left 1021827449 7:24569781-24569803 CCAGTCGGGATGCTCAGAGCTGG No data
Right 1021827453 7:24569798-24569820 AGCTGGGAACGGTGATCTTCAGG No data
1021827449_1021827457 28 Left 1021827449 7:24569781-24569803 CCAGTCGGGATGCTCAGAGCTGG No data
Right 1021827457 7:24569832-24569854 GACTAATCTGGAGAAGCTTTAGG No data
1021827449_1021827454 2 Left 1021827449 7:24569781-24569803 CCAGTCGGGATGCTCAGAGCTGG No data
Right 1021827454 7:24569806-24569828 ACGGTGATCTTCAGGCAGCCAGG No data
1021827449_1021827455 16 Left 1021827449 7:24569781-24569803 CCAGTCGGGATGCTCAGAGCTGG No data
Right 1021827455 7:24569820-24569842 GCAGCCAGGTGAGACTAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021827449 Original CRISPR CCAGCTCTGAGCATCCCGAC TGG (reversed) Intergenic