ID: 1021827450

View in Genome Browser
Species Human (GRCh38)
Location 7:24569781-24569803
Sequence CCAGTCGGGATGCTCAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021827445_1021827450 -2 Left 1021827445 7:24569760-24569782 CCAGCGGTTTGTAAACCAGTGCC No data
Right 1021827450 7:24569781-24569803 CCAGTCGGGATGCTCAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021827450 Original CRISPR CCAGTCGGGATGCTCAGAGC TGG Intergenic