ID: 1021827451

View in Genome Browser
Species Human (GRCh38)
Location 7:24569782-24569804
Sequence CAGTCGGGATGCTCAGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021827445_1021827451 -1 Left 1021827445 7:24569760-24569782 CCAGCGGTTTGTAAACCAGTGCC No data
Right 1021827451 7:24569782-24569804 CAGTCGGGATGCTCAGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021827451 Original CRISPR CAGTCGGGATGCTCAGAGCT GGG Intergenic
No off target data available for this crispr