ID: 1021827452

View in Genome Browser
Species Human (GRCh38)
Location 7:24569787-24569809
Sequence GGGATGCTCAGAGCTGGGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021827445_1021827452 4 Left 1021827445 7:24569760-24569782 CCAGCGGTTTGTAAACCAGTGCC No data
Right 1021827452 7:24569787-24569809 GGGATGCTCAGAGCTGGGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021827452 Original CRISPR GGGATGCTCAGAGCTGGGAA CGG Intergenic
No off target data available for this crispr