ID: 1021827454

View in Genome Browser
Species Human (GRCh38)
Location 7:24569806-24569828
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021827448_1021827454 8 Left 1021827448 7:24569775-24569797 CCAGTGCCAGTCGGGATGCTCAG No data
Right 1021827454 7:24569806-24569828 ACGGTGATCTTCAGGCAGCCAGG No data
1021827445_1021827454 23 Left 1021827445 7:24569760-24569782 CCAGCGGTTTGTAAACCAGTGCC No data
Right 1021827454 7:24569806-24569828 ACGGTGATCTTCAGGCAGCCAGG No data
1021827449_1021827454 2 Left 1021827449 7:24569781-24569803 CCAGTCGGGATGCTCAGAGCTGG No data
Right 1021827454 7:24569806-24569828 ACGGTGATCTTCAGGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021827454 Original CRISPR ACGGTGATCTTCAGGCAGCC AGG Intergenic